Exam 17: Genomes

Genomics has revealed that the bacterium that causes tuberculosis has more than 250 genes that metabolize lipids, many more than most bacteria have.What does this finding suggest about the bacterium and about medicinal approaches to this disease?

A drug that reduces blood pressure is broken down by an enzyme and becomes inactive.Individuals who have a more active enzyme will tend to have _______ blood pressure than those with the less active version of the enzyme and will thus need to take the drug _______ often.

The Denisovans are an extinct species of human that lived in Siberia several tens of thousands of years ago.We now have sequence information from these Denisovans.What evidence would best support Denisovans having had the capacity for speech?

Suppose, in contrast to the actual situation, that Neanderthals had a variant of the FOXP2 gene that resembled the chimpanzee variant more than the human variant.What would be the most reasonable inference based on this counterfactual finding?

Three overlapping reads are generated from sequencing.(Note: All reads are in a 5′-to-3′ direction.) Read 1: AAGCGAAGTCACTACGTAGC Read 2: CGTAGCAGGCGATCGGCA Read 3: AGTCGCGGCTAGCTTAAGCGA What is the correct order of the sequence?

Refer to the figure showing high-throughput sequencing. When are the DNA segments first separated by length?

Pathogenic strains of E.coli often exchange genes with other pathogenic bacteria such as Salmonella and Shigella.Refer to the table showing which bacteria contain various genes.(Note: "x" denotes presence of the gene.) Which gene most likely got into pathogenic E.coli from the other pathogenic bacteria?

What evidence suggests that Neanderthals may have had red hair?

Refer to the table comparing the genomes of E.coli and S.cerevisiae. The most striking difference between yeasts and bacteria in their numbers of genes is in the category of _______ genes.

Biologists have published a report showing the numbers of different genes in five different bacteria, correlating these findings to the environments in which the bacteria live and their evolutionary relationships.This report is best described as a study in

_______ add(s) dNTPs to DNA strands during high-throughput sequencing.

Refer to the figure showing microbial DNA being sequenced and analyzed. At what step(s) is/are DNA sequenced?

Arabidopsis has a genome size much smaller than that of many other plants.What is the most likely explanation for this phenomenon?

A well-funded team of biologists wishes to sequence the full genomes of several individual mice.The team would most likely use _______ sequencing to carry out this research program.

An enzyme in the liver activates a drug.Individuals with the GG genotype at an SNP have a variant of this enzyme that activates the drug more slowly than the variant that AA or AG individuals have.Most likely, GG individuals would require a _______ dose of the drug than other individuals.

A DNA sequence has been cut into the following four overlapping sequence fragments: (1) AGGGGCCTATAGCATACGTACA (2) CGTACATCTGAGGGTACGATCATGGC (3) CATGGCTAGCAAACGCGATCCCAAG (4) AGGCTAGTTACGATATAGGGGCC What is the correct order of these fragments?

Refer to the table showing the genotypes of a SNP and the average systolic blood pressure and LDL and HDL cholesterol levels associated with those genotypes. High LDL cholesterol levels and low HDL levels are generally associated with increased cardiovascular disease risk.Which statement is most likely to be true?

Suppose a scientist engineered the mass movement of transposable elements in the genomes of a group of fruit flies, and then these flies had offspring.A control group of flies that were from the same genetic strain but had not had a mass movement of transposable elements also had offspring.The most likely result would be that the average survival rate of the experimental offspring would be _______ than that of the control offspring, and that the genetic variance in the experimental offspring would be _______ in the control offspring.

Biologists are examining sequences from several species of bacteria in order to address whether bacteria that live in warmer conditions lose genes more rapidly than those from cooler conditions.Such a study is an example of _______.

The proteomes of eukaryotes are more complex than their genomes, but this is not true of prokaryotes.Which is not a major reason for this difference?