Exam 17: Genomes

A lab sequencing the DNA of various species of pathogenic bacteria with the goal of determining their evolutionary relationships would be practicing _______ genomics.

Butterflies use taste receptors to detect the presence of different foods.The receptors are encoded by genes in a gene family.Which circumstance would most likely lead to the evolution of pseudogenes in this gene family?

Below are four overlapping reads from sequencing.(Note: All reads are in the 5′-to-3′ direction.) Read 1: TTACACGCCATCGACTGGATCATATATGC Read 2: CATATATGCATGCAGCGCATGACCCCTAG Read 3: AGTCTGCAAATGCTGCGATTACACGCCA Read 4: CCCCTAGAGCTGGGGATCAGAGTCGATT In the correct order, read 3 is the first sequence, followed by read _______.

Recent studies show that baboons have different levels of hormones under different social settings.Such studies are best described as

The following are overlapping sequence fragments: AAGCGTGGCA, ATTCGGTAATAC, and TGGCATCGATTCGG.The larger sequence fragment is _______.(Note: All of the sequences have 5′-to-3′ polarity.)

The noncoding strand of a 10 bp fragment of DNA was cut in three different ways to yield the following subfragments: cut 1 yielded TG, ATG, and CCTAC; cut 2 yielded AT, GCC, and TACTG; and cut 3 yielded CTG, CTA, and ATGC.What is the correct sequence of the large fragment?

A pseudogene is

Refer to the hypothetical data set comparing the gene content of Salmonella and Shigella, of which all strains are pathogenic, and the pathogenic and nonpathogenic strains of E.coli.(Note: "x" denotes presence of the gene.) Which is the most likely conclusion about gene C?

Under which circumstance would a researcher most likely use Sanger sequencing instead of high-throughput sequencing?

In the high-throughput sequencing method, DNA is heated to

Pathogenic strains of E.coli often exchange genes with other pathogenic bacteria such as Salmonella and Shigella.Refer to the table showing which bacteria contain various genes.(Note: "x" denotes presence of the gene.) Which gene most likely got into pathogenic E.coli from the other pathogenic bacteria?

Refer to the table comparing the genomes of E.coli and S.cerevisiae. Which statement about the genomes of yeasts and nematodes is most likely to be true?

If the universal adapter sequence is 5′-GTCATTGCTTGCAATGTT-3′, which universal primer should be used for DNA sequencing?

A researcher finds that individuals with a particular genotype metabolize a drug faster than average, and she uses this information to provide genotype-specific guidelines for dosages of the drug.This is an example of

Craig Venter, a leader of one of the teams that sequenced the human genome, turned his attention to cataloging the microbial life of the oceans.His studies, which involve PCR amplification of microbial DNA and a sequencing of the PCR products, are part of a field of biology called

When scientists described the sequences of the proteins of Haemophilus influenzae based on its DNA sequence, what did they find to be the major difference between noninfective strains and highly infective strains?

Bacteria use colicins to kill other bacteria.Colicins are best described as

Like SNPs, differences in patterns of genes when they are cut with restriction enzymes can be used to examine associations between genetic differences and traits (including disease risk).Refer to the diagram showing the DNA profiles at a hypothetical locus in a family in which some individuals develop high cholesterol.Immediately below the genetic patterns are the cholesterol levels of the corresponding individuals.(Note: Readings above 200 are generally considered borderline high cholesterol, and those above 240 are considered high cholesterol.) What inferences can we draw from these results?

Comparison of the genomes of prokaryotes and eukaryotes has revealed several differences.Which characteristic of genomes is the most similar in prokaryotes and eukaryotes?

In which species or population would haplotype mapping be particularly challenging or practically impossible?