Exam 17: Genomes

A group of biologists is examining changes in the proteins in monkeys as they change in social status.This activity is best characterized as

Suppose a particular human chromosome is 50 million bp long (as haploid).If it is cut into fragments that are the same size as those typically used in high-throughput sequencing, about _______ fragments would be generated.

The most likely way that transposons disrupt the expression of other genes is by

Two overlapping DNA sequences arise from cutting a longer sequence: 5′-TGTAATGCTAAAGTAGTCATAGGC-3′ and 5′-AGGTATCTGTCAGTGTAATGCT-3′.The longer sequence is _______.

Studies investigating the genetic diversity of organisms within a sample of marsh soil, rather than the genomes of individual organisms, would be considered part of the burgeoning field of _______.

Which statement comparing the human and Neanderthal genomes is true?

The genomes of rice, wheat, and corn are similar to one another and to that of Arabidopsis in many ways.Discuss how these plants might nevertheless have very different proteins.

Refer to the figure showing microbial DNA being sequenced and analyzed. Studies like these would be most useful for questions related to

Which feature ensures that in the human placenta, oxygen will be transferred from the mother's blood to the developing fetus's blood?

Suppose a long sequence of DNA is cut with three different restriction enzymes: one that cuts at CTCG, one that cuts at TGCATC, and one that cuts at TCATGCTC.The restriction enzyme that cuts at _______ should produce the greatest number of fragments.

Highly repetitive sequences are often found in the transcriptionally inactive and densely packed region of a chromosome called _______.

Refer to the table showing several prokaryote (bacterial) species (labeled A-E) that have been sequenced, along with the findings of the genes they contain.(Note: "x" marks the species possessing a functional copy of the gene.) Gene 1 is essential for the synthesis of several amino acids.Gene 2 encodes a protein involved in strengthening the cell wall.Gene 3 produces an enzyme that breaks down methane.The functions of the other five genes are currently unknown. Which species has the most potential to be useful regarding studies of how global warming can be slowed?

It is the year 2025.You are taking care of a patient who is concerned about having an early stage of kidney cancer.His mother died from this disease.Assume that the SNPs linked to genes involved in the development of this type of cancer have been identified.How would you determine whether this man has a genetic predisposition for developing kidney cancer? Explain how you would do the analysis.

Following are four overlapping reads from sequencing.(Note: All reads are in a 5′-to-3′ direction.) Read 1: AGCGCTAAAGACGGCTCGAGTCAGCTAGTAGAA Read 2: TGCGTAGCTATCGCATACGCAAGCGCTAAA Read 3: GCTAGTAGAATCGATATCGAGGATCGATTAG Read 4: GGATCGATTAGAGCTATAGTAGGCTGATGAC Which reads share the sequence GCTAGTAGAA?

Refer to the table showing the number of genes in three bacteria (E.coli, Haemophilus influenzae, and Mycoplasma genitalium) for different functions. For which class of genes does M.genitalium devote a larger percentage of its genome than the other two bacteria do?

In the high-throughput sequencing method, _______ are labeled with colored fluorescent dyes.

In the process of high-throughput sequencing of DNA of an aphid, a researcher uses computer programs to determine the correct order of the reads, thus using a technique developed in the field of

In some species of moths, the genes that make the protein-rich chorion for the eggshell are found in multiple copies in order to maximize the production of chorion at specific times.In this regard, these chorion genes are most like

A hypothetical drug has a side effect of increasing blood pressure.Individuals who are homozygous for G at SNP 1 break down this drug faster than average.Individuals who are homozygous for A at SNP 2 break down this drug slower than average.The effects of these two SNPs roughly cancel each other out, such that homozygotes at both SNPs generally have average rates of breakdown of the enzyme.Which combination of genotypes is most likely to require an individual to take a larger than average dose of the drug to get the desired effect? (Note: The genotype of SNP 1 is listed first, followed by that of SNP 2.)

Two sequences both contain the same protein-coding gene.They differ only in that one has an enhancer and the other does not.We can thus say that the sequences differ