Question 1

A promoter is an example of a(n)

Accepted Answer

A)  open reading frame. 
B)  transposable element. 
C)  chromatin sequence. 
D)  rRNA gene. 
E)  regulatory sequence. 
A)  open reading frame. 
B)  transposable element. 
C)  chromatin sequence. 
D)  rRNA gene. 
E)  regulatory sequence.

Question 2

Two graduate students are working in the same lab.Jane is investigating the mariner transposon, a DNA transposon.Sam is studying Alu, a SINE.What property is shared by Jane's and Sam's elements?

Accepted Answer

A)  Both are transcribed and translated. 
B)  Both use an RNA intermediary. 
C)  Both use a "copy and paste" mechanism. 
D)  Both use a "cut and paste" mechanism. 
E)  Both are short tandem repeats. 
A)  Both are transcribed and translated. 
B)  Both use an RNA intermediary. 
C)  Both use a "copy and paste" mechanism. 
D)  Both use a "cut and paste" mechanism. 
E)  Both are short tandem repeats.

Question 3

What is the major distinction between primary and secondary metabolites?

Accepted Answer

A)  Primary metabolites are produced by animals; secondary metabolites are produced by plants. 
B)  Primary metabolites are produced by plants; secondary metabolites are produced by animals. 
C)  Primary metabolites are produced by eukaryotes; secondary metabolites are produced by prokaryotes. 
D)  Primary metabolites are produced by the breakdown of molecules; secondary metabolites are produced during the construction of larger molecules. 
E)  Primary metabolites are produced during ordinary activities; secondary metabolites are produced under special circumstances. 
A)  Primary metabolites are produced by animals; secondary metabolites are produced by plants. 
B)  Primary metabolites are produced by plants; secondary metabolites are produced by animals. 
C)  Primary metabolites are produced by eukaryotes; secondary metabolites are produced by prokaryotes. 
D)  Primary metabolites are produced by the breakdown of molecules; secondary metabolites are produced during the construction of larger molecules. 
E)  Primary metabolites are produced during ordinary activities; secondary metabolites are produced under special circumstances.

Question 4

You are a researcher wanting to study cellular movement during animal development.An organism that had a transparent body would be ideal.What would be the best model organism to study?

Accepted Answer

A)  Saccharomyces cerevisiae 
B)  Caenorhabditis elegans 
C)  Drosophila melanogaster 
D)  Arabidopsis thaliana 
E)  Salmonella enterica 
A)  Saccharomyces cerevisiae 
B)  Caenorhabditis elegans 
C)  Drosophila melanogaster 
D)  Arabidopsis thaliana 
E)  Salmonella enterica

Question 5

Where would you most likely find introns?

Accepted Answer

A)  A tRNA gene of an archean species 
B)  A gene involved in central metabolism in an archean species 
C)  A gene involved in the formation of the cell wall of a bacterial species 
D)  A gene involved in central metabolism in a bacterial species 
E)  A tRNA gene of a bacterial species 
A)  A tRNA gene of an archean species 
B)  A gene involved in central metabolism in an archean species 
C)  A gene involved in the formation of the cell wall of a bacterial species 
D)  A gene involved in central metabolism in a bacterial species 
E)  A tRNA gene of a bacterial species

Question 6

Under which circumstance will a researcher most likely use Sanger sequencing instead of high-throughput sequencing?

Accepted Answer

A)  If the researcher is undertaking a metagenomic study and is sequencing primarily prokaryotes 
B)  If the researcher is undertaking a metagenomic study and is sequencing primarily eukaryotes 
C)  If the researcher has a small lab, lacks miniaturization equipment, and plans to sequence only a relatively small amount 
D)  If the researcher is doing a comparative genomic study 
E)  If the researcher is doing a functional genomic study 
A)  If the researcher is undertaking a metagenomic study and is sequencing primarily prokaryotes 
B)  If the researcher is undertaking a metagenomic study and is sequencing primarily eukaryotes 
C)  If the researcher has a small lab, lacks miniaturization equipment, and plans to sequence only a relatively small amount 
D)  If the researcher is doing a comparative genomic study 
E)  If the researcher is doing a functional genomic study

Question 7

A DNA sequence has been cut into the following three overlapping sequence fragments: 
(1) CCGCGCGTAGCGAGTCAG
(2) GGCTAGTTAGCTCCGCGCG
(3) AGTCAGTCAAAAT
What is the correct assembled sequence of these fragments?

Accepted Answer

A)  GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT 
B)  CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT 
C)  CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG 
D)  AGTCAGTCAAAATGTCAGCAGTCAAAAT 
E)  GGCTAGTTAGCTCCGCGCGAGTCAGTCAAAAT 
A)  GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT 
B)  CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT 
C)  CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG 
D)  AGTCAGTCAAAATGTCAGCAGTCAAAAT 
E)  GGCTAGTTAGCTCCGCGCGAGTCAGTCAAAAT

Question 8

Refer to the table showing the properties of five different genomes.   Which genome is most likely prokaryotic?

Accepted Answer

A)  Genome A 
B)  Genome B 
C)  Genome C 
D)  Genome D 
E)  Genome E 
A)  Genome A 
B)  Genome B 
C)  Genome C 
D)  Genome D 
E)  Genome E

Question 9

Refer to the table showing transposable elements that have been inserted into various genes (labeled A-E).(Note: "x" indicates the genes that have been knocked out in each experiment, "+" indicates that the bacteria can grow, and "-" indicates that the bacteria cannot grow.)   What are the minimal genomes?

Accepted Answer

A)  Genes A and B 
B)  Genes A, B, and C 
C)  Genes A, B, and D 
D)  Genes C and D 
E)  Genes C and E 
A)  Genes A and B 
B)  Genes A, B, and C 
C)  Genes A, B, and D 
D)  Genes C and D 
E)  Genes C and E

Question 10

A DNA sequence is cut by two different restriction enzymes (1 and 2).
Digestion from enzyme 1 yields the following fragments (read in the 5ʹ-to-3ʹ direction): CGATAC, GTCGTCGCC, and GTTATCGCGAC.Digestion from enzyme 2 yields the following fragments (read in the 5ʹ-to-3ʹ direction): CGACGTCGTCGCC and CGATACGTTATCG.
Which sequence does enzyme 1 recognize as a site at which to cut? 
(Note that the enzyme cuts in the middle of its recognition sequence.)

Accepted Answer

A)  GTTA 
B)  ACGT 
C)  TGGA 
D)  CGCG 
E)  GTCG 
A)  GTTA 
B)  ACGT 
C)  TGGA 
D)  CGCG 
E)  GTCG

Question 11

A hypothetical drug has a side effect of increasing blood pressure.Individuals who are homozygous T at SNP 1 break down this drug faster than average.Individuals who are homozygous A at SNP 2 break down this drug slower than average.The effects of these two SNPs roughly cancel each other out, such that homozygotes at both SNPs generally have average rates of breakdown of the enzyme.Which individual is most likely to be at risk for having the side effect? (Note: The genotype of SNP 1 is presented first, followed by that of SNP 2.)

Accepted Answer

A)  TT, AA 
B)  TT, AT 
C)  TC, AA 
D)  TC, AT 
E)  TC, TT 
A)  TT, AA 
B)  TT, AT 
C)  TC, AA 
D)  TC, AT 
E)  TC, TT

Question 12

Refer to the table showing several prokaryote (bacterial) species (labeled A-E) that have been sequenced, along with the findings of the genes they contain.(Note: "x" marks the species possessing a functional copy of the gene.) Gene 1 is essential for the synthesis of several amino acids.Gene 2 encodes a protein involved in strengthening the cell wall.Gene 3 produces an enzyme that breaks down methane.The functions of the other five genes are currently unknown.   What type of study best characterizes what the researchers did?

Accepted Answer

A)  Functional genomics 
B)  Metagenomics 
C)  Comparative genomics 
D)  Haplotype mapping 
E)  Microbiomics 
A)  Functional genomics 
B)  Metagenomics 
C)  Comparative genomics 
D)  Haplotype mapping 
E)  Microbiomics

Question 13

Which genome is most likely to be that of a free-living prokaryote?

Accepted Answer

A)  A genome that is 300 million bp long with over 50 percent repetitive DNA and many introns 
B)  A genome that is 16,000 bp long, arranged in a circle 
C)  A genome that is 3 million bp long, arranged in a single circular chromosome, and with little repetitive DNA 
D)  A genome that is 3 million bp long, arranged in many linear chromosomes, and with many introns 
E)  A genome that is 3 million bp long with many introns 
A)  A genome that is 300 million bp long with over 50 percent repetitive DNA and many introns 
B)  A genome that is 16,000 bp long, arranged in a circle 
C)  A genome that is 3 million bp long, arranged in a single circular chromosome, and with little repetitive DNA 
D)  A genome that is 3 million bp long, arranged in many linear chromosomes, and with many introns 
E)  A genome that is 3 million bp long with many introns

Question 14

The Denisovans are an extinct species of human that lived in Siberia several tens of thousands of years ago.We now have sequence information from these Denisovans.What evidence would best support Denisovans having had red hair?

Accepted Answer

A)  The Denisovan MC1R protein variant had greater activity than the typical human variant. 
B)  The Denisovan MC1R protein variant had lower activity than the typical human variant. 
C)  The Denisovan FOXP2 protein variant had greater activity than the typical human variant. 
D)  The Denisovan FOXP2 gene was inactivated. 
E)  The Denisovan FOXP2 gene underwent accelerated evolution. 
A)  The Denisovan MC1R protein variant had greater activity than the typical human variant. 
B)  The Denisovan MC1R protein variant had lower activity than the typical human variant. 
C)  The Denisovan FOXP2 protein variant had greater activity than the typical human variant. 
D)  The Denisovan FOXP2 gene was inactivated. 
E)  The Denisovan FOXP2 gene underwent accelerated evolution.

Question 15

Which observation would best contradict the notion of genetic determinism?

Accepted Answer

A)  Many genes show accelerated evolution in humans and chimpanzees. 
B)  Only a single protein variant is produced from a particular gene. 
C)  Monozygotic twins diverge in their appearance as they age. 
D)  Analysis of the Neanderthal genome shows that they likely had red hair. 
E)  The FOXP2 gene is involved in vocalization in both humans and birds. 
A)  Many genes show accelerated evolution in humans and chimpanzees. 
B)  Only a single protein variant is produced from a particular gene. 
C)  Monozygotic twins diverge in their appearance as they age. 
D)  Analysis of the Neanderthal genome shows that they likely had red hair. 
E)  The FOXP2 gene is involved in vocalization in both humans and birds.

Question 16

The presence of _______ proteins that attach to the respiratory tract is a key determinant of whether Haemophilus influenzae strains will be infectious.

Accepted Answer

The answer of The presence of _______ proteins that attach...

Question 17

A gene involved in fatty acid metabolism duplicates.Via mutation and selection, these genes diverge in function.There is subsequent duplication and divergence.The resulting genes are all part of the same _______.

Accepted Answer

The answer of A gene involved in fatty acid metabolism...

Question 18

Refer to the table showing several prokaryote species (labeled F-J) that have been sequenced, and the genes they contain.(Note: "x" marks the species possessing a functional copy of the gene.)   None of these species is closely related.Which two species are most likely exchanging genes? Explain your answer.

Accepted Answer

Species H and J are most likel

Question 19

Refer to the table showing several prokaryote (bacterial) species (labeled A-E) that have been sequenced, along with the findings of the genes they contain.(Note: "x" marks the species possessing a functional copy of the gene.) Gene 1 is essential for the synthesis of several amino acids.Gene 2 encodes a protein involved in strengthening the cell wall.Gene 3 produces an enzyme that breaks down methane.The functions of the other five genes are currently unknown.   Which species would be most likely to withstand extreme conditions?

Accepted Answer

A)  Species A 
B)  Species B 
C)  Species C 
D)  Species D 
E)  Species E 
A)  Species A 
B)  Species B 
C)  Species C 
D)  Species D 
E)  Species E

Question 20

In comparison with Sanger sequencing, in high-throughput DNA sequencing,

Accepted Answer

A)  very long fragments (>10,000 bp) can be reliably sequenced. 
B)  DNA is not heated to separate the strands. 
C)  primers are not needed. 
D)  synthetic nucleotides are not used. 
E)  chemically modified nucleotides are not used. 
A)  very long fragments (>10,000 bp) can be reliably sequenced. 
B)  DNA is not heated to separate the strands. 
C)  primers are not needed. 
D)  synthetic nucleotides are not used. 
E)  chemically modified nucleotides are not used.

Exam 17: Genomes

A promoter is an example of a(n)

Two graduate students are working in the same lab.Jane is investigating the mariner transposon, a DNA transposon.Sam is studying Alu, a SINE.What property is shared by Jane's and Sam's elements?

What is the major distinction between primary and secondary metabolites?

You are a researcher wanting to study cellular movement during animal development.An organism that had a transparent body would be ideal.What would be the best model organism to study?

Where would you most likely find introns?

Under which circumstance will a researcher most likely use Sanger sequencing instead of high-throughput sequencing?

A DNA sequence has been cut into the following three overlapping sequence fragments: (1) CCGCGCGTAGCGAGTCAG (2) GGCTAGTTAGCTCCGCGCG (3) AGTCAGTCAAAAT What is the correct assembled sequence of these fragments?

Refer to the table showing the properties of five different genomes. Which genome is most likely prokaryotic?

Which genome is most likely to be that of a free-living prokaryote?

The Denisovans are an extinct species of human that lived in Siberia several tens of thousands of years ago.We now have sequence information from these Denisovans.What evidence would best support Denisovans having had red hair?

Which observation would best contradict the notion of genetic determinism?

The presence of _______ proteins that attach to the respiratory tract is a key determinant of whether Haemophilus influenzae strains will be infectious.

A gene involved in fatty acid metabolism duplicates.Via mutation and selection, these genes diverge in function.There is subsequent duplication and divergence.The resulting genes are all part of the same _______.

In comparison with Sanger sequencing, in high-throughput DNA sequencing,

Studying Life

Small Molecules and the Chemistry of Life

Proteins, Carbohydrates, and Lipids

Nucleic Acids and the Origin of Life

Cells: the Working Units of Life

Cell Membranes

Cell Communication and Multicellularity

Energy, Enzymes, and Metabolism

Pathways That Harvest Chemical Energy

Photosynthesis: Energy From Sunlight

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

Dna and Its Role in Heredity

From Dna to Protein: Gene Expression

Gene Mutation and Molecular Medicine

Regulation of Gene Expression

Recombinant Dna and Biotechnology

Mechanisms of Evolution

Reconstructing and Using Phylogenies

Speciation

Evolution of Genes and Genomes

The History of Life on Earth

Bacteria, Archaea, and Viruses

The Origin and Diversification of Eukaryotes

Plants Without Seeds: From Water to Land

The Evolution of Seed Plants

The Evolution and Diversity of Fungi

Animal Origins and the Evolution of Body Plans

Protostome Animals

Deuterostome Animals

The Plant Body

Transport in Plants

Plant Nutrition

Regulation of Plant Growth

Reproduction in Flowering Plants

Plant Responses to Environmental Challenges

Physiology, Homeostasis, and Temperature Regulation

Animal Hormones

Immunology: Animal Defense Systems

Animal Reproduction

Animal Development

Neurons, Glia, and Nervous Systems

Sensory Systems

The Mammalian Nervous System: Structure and Higher Functions

Musculoskeletal Systems

Gas Exchange

Circulatory Systems

Nutrition, Digestion, and Absorption

Salt and Water Balance and Nitrogen Excretion

Animal Behavior

The Physical Environment and Biogeography of Life

Populations

Species Interactions

Communities

Ecosystems

A Changing Biosphere

Filters