Multiple Choice
A DNA sequence has been cut into the following four overlapping sequence fragments:
(1) AGGGGCCTATAGCATACGTACA
(2) CGTACATCTGAGGGTACGATCATGGC
(3) CATGGCTAGCAAACGCGATCCCAAG
(4) AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?
A) 1, 2, 3, 4
B) 1, 3, 2, 4
C) 2, 3, 1, 4
D) 4, 1, 2, 3
E) 4, 1, 3, 2
Correct Answer:
Verified
Correct Answer:
Verified
Q151: _ add(s) dNTPs to DNA strands during
Q152: Refer to the figure showing microbial DNA
Q153: Arabidopsis has a genome size much smaller
Q154: A well-funded team of biologists wishes to
Q155: An enzyme in the liver activates a
Q157: Refer to the table showing the genotypes
Q158: Suppose a scientist engineered the mass movement
Q159: Biologists are examining sequences from several species
Q160: The proteomes of eukaryotes are more complex
Q161: A promoter is an example of a(n)<br>A)