Question 1

Genomics has revealed that the bacterium that causes tuberculosis has more than 250 genes that metabolize lipids, many more than most bacteria have.What does this finding suggest about the bacterium and about medicinal approaches to this disease?

Accepted Answer

The answer of Genomics has revealed that the bacterium that...

Question 2

A drug that reduces blood pressure is broken down by an enzyme and becomes inactive.Individuals who have a more active enzyme will tend to have _______ blood pressure than those with the less active version of the enzyme and will thus need to take the drug _______ often.

Accepted Answer

A)  higher; more 
B)  higher; less 
C)  more responsive; less 
D)  lower; more 
E)  lower; less

Question 3

The Denisovans are an extinct species of human that lived in Siberia several tens of thousands of years ago.We now have sequence information from these Denisovans.What evidence would best support Denisovans having had the capacity for speech?

Accepted Answer

A)  The Denisovan MC1R protein variant had the same activity as the typical human variant. 
B)  The Denisovan MC1R gene resembled the human but not the chimpanzee variant. 
C)  The Denisovan MC1R gene resembled the chimpanzee but not the human variant. 
D)  The Denisovan FOXP2 protein variant had lower activity than the typical human variant. 
E)  The Denisovan FOXP2 gene resembled the human but not the chimpanzee variant.

Question 4

Suppose, in contrast to the actual situation, that Neanderthals had a variant of the FOXP2 gene that resembled the chimpanzee variant more than the human variant.What would be the most reasonable inference based on this counterfactual finding?

Accepted Answer

A)  Neanderthals had red hair. 
B)  Neanderthals did not have red hair. 
C)  Neanderthals lacked the capacity for complex speech and language. 
D)  Humans and Neanderthals exchanged genes by interbreeding. 
E)  Humans and Neanderthals evolved in separate regions.

Question 5

Three overlapping reads are generated from sequencing.(Note: All reads are in a 5′-to-3′ direction.) Read 1: AAGCGAAGTCACTACGTAGC
Read 2: CGTAGCAGGCGATCGGCA
Read 3: AGTCGCGGCTAGCTTAAGCGA
What is the correct order of the sequence?

Accepted Answer

A)  AGTCGCGGCTAGCTTAAGCGAAAGCGAAGTCACTACGTAGCCGTAGCAGGCGATCGGCA 
B)  AGTCGCGGCTAGCTTAAGCGAAGTCACTACGTAGCAGGCGATCGGCA 
C)  AAGCGAAGTCACTACGTAGCCGTAGCAGGCGATCGGCAAGTCGCGGCTAGCTTAAGCGA 
D)  AAGCGAAGTCACTACGTAGCAGTCGCGGCTAGCTTAAGCGA 
E)  AGTCGCGGCTAGCTTAAGCGAAAGCGAAGTCACTACGTAGC

Question 6

Refer to the figure showing high-throughput sequencing.  When are the DNA segments first separated by length?

Accepted Answer

The answer of Refer to the figure showing high-throughput sequencing....

Question 7

Pathogenic strains of E.coli often exchange genes with other pathogenic bacteria such as Salmonella and Shigella.Refer to the table showing which bacteria contain various genes.(Note: "x" denotes presence of the gene.)  Which gene most likely got into pathogenic E.coli from the other pathogenic bacteria?

Accepted Answer

A)  Gene A 
B)  Gene B 
C)  Gene C 
D)  Gene D 
E)  Gene E

Question 8

What evidence suggests that Neanderthals may have had red hair?

Accepted Answer

A)  Neanderthals had a FOXP2 gene that appears to be more actively expressed in cell culture than the human variant. 
B)  Neanderthals had a FOXP2 gene that appears to be less actively expressed in cell culture than the human variant. 
C)  Neanderthals had an MC1R gene that appears to be more actively expressed in cell culture than the human variant. 
D)  Neanderthals had an MC1R gene that appears to be less actively expressed in cell culture than the human variant. 
E)  Neanderthals lacked the MC1R gene.

Question 9

Refer to the table comparing the genomes of E.coli and S.cerevisiae.  The most striking difference between yeasts and bacteria in their numbers of genes is in the category of _______ genes.

Accepted Answer

A)  metabolism 
B)  transcription 
C)  translation 
D)  protein-targeting 
E)  DNA repair and replication

Question 10

Biologists have published a report showing the numbers of different genes in five different bacteria, correlating these findings to the environments in which the bacteria live and their evolutionary relationships.This report is best described as a study in

Accepted Answer

A)  metagenomics. 
B)  functional genomics. 
C)  comparative genomics. 
D)  relational genomics. 
E)  proteomics.

Question 11

_______ add(s) dNTPs to DNA strands during high-throughput sequencing.

Accepted Answer

A)  DNA polymerase 
B)  RNA polymerase 
C)  Synthetic oligonucleotides 
D)  Fluorescent dyes 
E)  Heat

Question 12

Refer to the figure showing microbial DNA being sequenced and analyzed.  At what step(s) is/are DNA sequenced?

Accepted Answer

A)  Only step 1 
B)  Only step 2 
C)  Only step 3 
D)  Both steps 1 and 2 
E)  Both steps 2 and 3

Question 13

Arabidopsis has a genome size much smaller than that of many other plants.What is the most likely explanation for this phenomenon?

Accepted Answer

A)  Compared with most plants, it has fewer of the genes that are shared with animals. 
B)  Compared with most plants, it has fewer genes devoted to photosynthesis. 
C)  Compared with most plants, it has less noncoding DNA. 
D)  Compared with most plants, it has fewer genes that are involved in water transport. 
E)  Compared with most plants, it has fewer genes that are involved with formation of the cell wall.

Question 14

A well-funded team of biologists wishes to sequence the full genomes of several individual mice.The team would most likely use _______ sequencing to carry out this research program.

Accepted Answer

The answer of A well-funded team of biologists wishes to...

Question 15

An enzyme in the liver activates a drug.Individuals with the GG genotype at an SNP have a variant of this enzyme that activates the drug more slowly than the variant that AA or AG individuals have.Most likely, GG individuals would require a _______ dose of the drug than other individuals.

Accepted Answer

The answer of An enzyme in the liver activates a...

Question 16

A DNA sequence has been cut into the following four overlapping sequence fragments: 
(1) AGGGGCCTATAGCATACGTACA
(2) CGTACATCTGAGGGTACGATCATGGC
(3) CATGGCTAGCAAACGCGATCCCAAG
(4) AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?

Accepted Answer

A)  1, 2, 3, 4 
B)  1, 3, 2, 4 
C)  2, 3, 1, 4 
D)  4, 1, 2, 3 
E)  4, 1, 3, 2

Question 17

Refer to the table showing the genotypes of a SNP and the average systolic blood pressure and LDL and HDL cholesterol levels associated with those genotypes.  High LDL cholesterol levels and low HDL levels are generally associated with increased cardiovascular disease risk.Which statement is most likely to be true?

Accepted Answer

A)  AA individuals are at higher risk of cardiovascular disease due to increased blood pressure. 
B)  GG individuals are at higher risk of cardiovascular disease due to increased blood pressure. 
C)  AA individuals are at higher risk of cardiovascular disease due to their LDL levels. 
D)  GG individuals are at higher risk of cardiovascular disease due to their LDL levels. 
E)  GG individuals are at higher risk of cardiovascular disease due to their HDL levels.

Question 18

Suppose a scientist engineered the mass movement of transposable elements in the genomes of a group of fruit flies, and then these flies had offspring.A control group of flies that were from the same genetic strain but had not had a mass movement of transposable elements also had offspring.The most likely result would be that the average survival rate of the experimental offspring would be _______ than that of the control offspring, and that the genetic variance in the experimental offspring would be _______ in the control offspring.

Accepted Answer

A)  higher; greater than 
B)  higher; roughly the same as 
C)  higher; lower than 
D)  lower; higher than 
E)  lower; lower than

Question 19

Biologists are examining sequences from several species of bacteria in order to address whether bacteria that live in warmer conditions lose genes more rapidly than those from cooler conditions.Such a study is an example of _______.

Accepted Answer

The answer of Biologists are examining sequences from several species...

Question 20

The proteomes of eukaryotes are more complex than their genomes, but this is not true of prokaryotes.Which is not a major reason for this difference?

Accepted Answer

A)  Basic metabolism, such as glycolysis, differs in eukaryotes and prokaryotes. 
B)  Eukaryote genes can encode more than one protein. 
C)  Alternative splicing leads to different combinations of exons in eukaryotes. 
D)  Posttranslational modifications can lead to protein variants in eukaryotes. 
E)  Many proteins can be produced only by certain cells under certain conditions.

Exam 17: Genomes

Genomics has revealed that the bacterium that causes tuberculosis has more than 250 genes that metabolize lipids, many more than most bacteria have.What does this finding suggest about the bacterium and about medicinal approaches to this disease?

A drug that reduces blood pressure is broken down by an enzyme and becomes inactive.Individuals who have a more active enzyme will tend to have _ blood pressure than those with the less active version of the enzyme and will thus need to take the drug _ often.

The Denisovans are an extinct species of human that lived in Siberia several tens of thousands of years ago.We now have sequence information from these Denisovans.What evidence would best support Denisovans having had the capacity for speech?

Suppose, in contrast to the actual situation, that Neanderthals had a variant of the FOXP2 gene that resembled the chimpanzee variant more than the human variant.What would be the most reasonable inference based on this counterfactual finding?

Three overlapping reads are generated from sequencing.(Note: All reads are in a 5′-to-3′ direction.) Read 1: AAGCGAAGTCACTACGTAGC Read 2: CGTAGCAGGCGATCGGCA Read 3: AGTCGCGGCTAGCTTAAGCGA What is the correct order of the sequence?

Refer to the figure showing high-throughput sequencing. When are the DNA segments first separated by length?