Question 1

Which change is a transition?

Accepted Answer

A)  A change from A to G 
B)  A change from A to C 
C)  A change from T to G 
D)  A change from C to G 
E)  A change from C to G and back to C 
A)  A change from A to G 
B)  A change from A to C 
C)  A change from T to G 
D)  A change from C to G 
E)  A change from C to G and back to C

Question 2

Flying squirrels and flying lemurs do not actually fly but glide.They are able to glide because of the development of a patagium, a membrane that stretches from the forelimb to hindlimb on each side of the body.The independent development of this trait in two species that do not share a recent common ancestor with this trait indicates _______ evolution has occurred.

Accepted Answer

A)  directed 
B)  convergent 
C)  divergent 
D)  genetic drift 
E)  synonymous 
A)  directed 
B)  convergent 
C)  divergent 
D)  genetic drift 
E)  synonymous

Question 3

A gene found in E.coli is not found in closely related species of bacteria, but similar genes are found in distantly related bacteria.This is most likely due to _______.

Accepted Answer

lateral ge

Question 4

Which scenario would be the least likely result of gene duplication?

Accepted Answer

A)  The gene produces less of its product than it did before duplication. 
B)  The two copies of the gene are expressed at different stages in the development of the organism. 
C)  As a result of evolutionary divergence, one copy retains its original function and the other copy acquires a different function. 
D)  One copy remains functional and the other copy evolves into a functionless pseudogene. 
E)  The product of the gene is expressed at greater levels than before duplication. 
A)  The gene produces less of its product than it did before duplication. 
B)  The two copies of the gene are expressed at different stages in the development of the organism. 
C)  As a result of evolutionary divergence, one copy retains its original function and the other copy acquires a different function. 
D)  One copy remains functional and the other copy evolves into a functionless pseudogene. 
E)  The product of the gene is expressed at greater levels than before duplication.

Question 5

Which statement about genomes is true?

Accepted Answer

A)  The genome sizes of all plants are smaller than those of all animals. 
B)  Humans have the largest genome size of all animals. 
C)  Most of the bacterial genome is noncoding. 
D)  The size of the genome is in direct proportion to the complexity of the organism. 
E)  The size of the genome varies widely among organisms. 
A)  The genome sizes of all plants are smaller than those of all animals. 
B)  Humans have the largest genome size of all animals. 
C)  Most of the bacterial genome is noncoding. 
D)  The size of the genome is in direct proportion to the complexity of the organism. 
E)  The size of the genome varies widely among organisms.

Question 6

Which statement about mutations is false?

Accepted Answer

A)  A silent mutation results in no change in the amino acid sequence of a protein. 
B)  According to the neutral theory of molecular evolution, most substitution mutations are selectively neutral and accumulate through genetic drift. 
C)  A base substitution mutation in the third codon position is more likely to be neutral than a substitution at the first or second codon position. 
D)  Nonsynonymous mutations are virtually always deleterious to the organism. 
E)  The rate of fixation of neutral mutations is equal to the mutation rate and is independent of population size. 
A)  A silent mutation results in no change in the amino acid sequence of a protein. 
B)  According to the neutral theory of molecular evolution, most substitution mutations are selectively neutral and accumulate through genetic drift. 
C)  A base substitution mutation in the third codon position is more likely to be neutral than a substitution at the first or second codon position. 
D)  Nonsynonymous mutations are virtually always deleterious to the organism. 
E)  The rate of fixation of neutral mutations is equal to the mutation rate and is independent of population size.

Question 7

A biologist is examining the gene tree of a gene family of hormone receptor proteins.Which gene forms should she compare when focusing on changes in function due to gene duplication?

Accepted Answer

A)  Orthologs 
B)  Paralogs 
C)  Analogs 
D)  Heterologs 
E)  Monologs 
A)  Orthologs 
B)  Paralogs 
C)  Analogs 
D)  Heterologs 
E)  Monologs

Question 8

Two species of plants that diverged 20 million years ago have accumulated an estimated 10 nucleotide differences in gene X.Species A has had an average population size of 3 million, while species B has had an average population size of 0.5 million.Both of these plants are annuals, with one generation per year.Assuming that the substitutions are all neutral, what is the estimated neutral mutation rate of gene X per million generations?

Accepted Answer

A)  0.25 
B)  0.5 
C)  1 
D)  1.5 
E)  3 
A)  0.25 
B)  0.5 
C)  1 
D)  1.5 
E)  3

Question 9

Suppose three sibling species of frogs have the following DNA sequences at a portion of a gene: Species 1: AGTCTAGATCGCGGTCG
Species 2: AGTCGATCGCGGACG
Species 3: TGTCTAGATCACGGTCG
Recall that the observed number of mutations can differ from the total number of actual substitutions that occurred in pairwise sequence comparisons.If we assume that a gap of any length is equivalent to three nucleotide substitutions, how many substitutions have occurred between species 1 and species 3?

Accepted Answer

A)  1 
B)  2 
C)  3 
D)  4 
E)  5 
A)  1 
B)  2 
C)  3 
D)  4 
E)  5

Question 10

Which possible mechanism of concerted evolution would not change the number of copies of a repeated sequence on a chromosome?

Accepted Answer

A)  Lateral gene transfer 
B)  Unequal crossing over 
C)  Biased gene conversion 
D)  Purifying selection 
E)  Positive selection 
A)  Lateral gene transfer 
B)  Unequal crossing over 
C)  Biased gene conversion 
D)  Purifying selection 
E)  Positive selection

Question 11

Refer to the figure.   In humans, STAT6, STAT5a, and STAT5b transcription factors are paralogs.According to the phylogenetic gene tree shown, since the gene duplication event that gave rise to the STAT6 and STAT5 lineages, how many gene duplication events have occurred to generate human STAT5a and human STAT5b?

Accepted Answer

A)  One 
B)  Two 
C)  Three 
D)  Five 
E)  Six 
A)  One 
B)  Two 
C)  Three 
D)  Five 
E)  Six

Question 12

Detection of _______ substitutions requires knowing the sequence of intermediates between the common ancestor and the descendant colonies, in addition to that of the two colonies and the common ancestor.

Accepted Answer

A)  coincident 
B)  back 
C)  multiple 
D)  both coincident and back 
E)  both back and multiple 
A)  coincident 
B)  back 
C)  multiple 
D)  both coincident and back 
E)  both back and multiple

Question 13

Below are the DNA sequences from four hypothetical species of bacteria.
Species 1: AGAGAATCTGCCATGAACTGA
Species 2: AGAGAGTCTGCGCATGCACTGA
Species 3: AGAAAGTGTCAGCGGATGCACTCA
Species 4: AGAAAGTGTCAGCGCATGCACTCA
Which two pairs of species are most likely to be most closely related?

Accepted Answer

Species 1

Question 14

In a hypothetical experiment, researchers sequence a gene from a colony of bacteria at various times in the history of the colony.In the common ancestor, the nucleotide at site 998 is A.After 1,500 generations, it changes to G.After 5,000 generations, it changes back to A.This is an example of a(n)

Accepted Answer

A)  inversion. 
B)  coincident substitution. 
C)  parallel substitution. 
D)  transversion. 
E)  reversion. 
A)  inversion. 
B)  coincident substitution. 
C)  parallel substitution. 
D)  transversion. 
E)  reversion.

Question 15

Refer to the figure showing the hypothetical observed sequences from two related species and their common ancestor.   How many substitutions have actually occurred between species 1 and species 2?

Accepted Answer

The answer of Refer to the figure showing the hypothetical...

Question 16

Suppose that the size of a population of midges is 20 million and that the mutation rate of a neutral gene is 1.5 per million.How many new mutations of this gene should appear in the population per generation?

Accepted Answer

A)  1.5 
B)  3 
C)  20 
D)  30 
E)  60 
A)  1.5 
B)  3 
C)  20 
D)  30 
E)  60

Question 17

Which statement about genomes is true?

Accepted Answer

A)  The variation in genome size among animals is greater than the variation in the number of protein-coding genes. 
B)  The variation in genome size among animals is less than the variation in the number of protein-coding genes. 
C)  Most of the DNA in humans codes for proteins. 
D)  The salamander genome has about 40 times more protein-coding genes than the human genome has. 
E)  The lungfish is a considerably more complex organism than the salamander. 
A)  The variation in genome size among animals is greater than the variation in the number of protein-coding genes. 
B)  The variation in genome size among animals is less than the variation in the number of protein-coding genes. 
C)  Most of the DNA in humans codes for proteins. 
D)  The salamander genome has about 40 times more protein-coding genes than the human genome has. 
E)  The lungfish is a considerably more complex organism than the salamander.

Question 18

Below are short fragments of DNA sequences from two yeast strains (A and B), which have been diverging from each other, as well as a short fragment from their common ancestor (C). Yeast A: TGACTGCAAACATCCTAG
Yeast B: TGCCTGGACACATCGAAG
Yeast C: TGCCTGGAAACCTCCTAG
Based on the information from all three sequences, there is evidence for _______ parallel substitution(s) and _______ coincident substitution(s).

Accepted Answer

A)  zero; one 
B)  one; zero 
C)  one; one 
D)  one; two 
E)  two; zero 
A)  zero; one 
B)  one; zero 
C)  one; one 
D)  one; two 
E)  two; zero

Question 19

Suppose the size of a population of whales is 2,400 individuals.According to genetic drift theory, what is the probability that a newly arisen neutral mutation will become fixed in this population?

Accepted Answer

A)  1/2 
B)  1/1,200 
C)  1/2,400 
D)  1/4,800 
E)  1/6,000 
A)  1/2 
B)  1/1,200 
C)  1/2,400 
D)  1/4,800 
E)  1/6,000

Question 20

Which statement about the enzyme lysozyme is true?

Accepted Answer

A)  A small group of closely related mammals has evolved a special form of lysozyme that functions in digestion. 
B)  The lysozymes found in the foregut fermenters resulted from convergent evolution. 
C)  Lysozyme could not have evolved a secondary function if it had been an enzyme with a vital primary function. 
D)  A high mutation rate in foregut fermenters allows their lysozymes to evolve rapidly. 
E)  Lysozymes first evolved as a defense against bacteria in the common ancestor of mammals. 
A)  A small group of closely related mammals has evolved a special form of lysozyme that functions in digestion. 
B)  The lysozymes found in the foregut fermenters resulted from convergent evolution. 
C)  Lysozyme could not have evolved a secondary function if it had been an enzyme with a vital primary function. 
D)  A high mutation rate in foregut fermenters allows their lysozymes to evolve rapidly. 
E)  Lysozymes first evolved as a defense against bacteria in the common ancestor of mammals.

Exam 23: Evolution of Genes and Genomes

Which change is a transition?

A gene found in E.coli is not found in closely related species of bacteria, but similar genes are found in distantly related bacteria.This is most likely due to _______.

Which scenario would be the least likely result of gene duplication?

Which statement about genomes is true?

Which statement about mutations is false?

A biologist is examining the gene tree of a gene family of hormone receptor proteins.Which gene forms should she compare when focusing on changes in function due to gene duplication?

Which possible mechanism of concerted evolution would not change the number of copies of a repeated sequence on a chromosome?

Detection of _______ substitutions requires knowing the sequence of intermediates between the common ancestor and the descendant colonies, in addition to that of the two colonies and the common ancestor.

Below are the DNA sequences from four hypothetical species of bacteria. Species 1: AGAGAATCTGCCATGAACTGA Species 2: AGAGAGTCTGCGCATGCACTGA Species 3: AGAAAGTGTCAGCGGATGCACTCA Species 4: AGAAAGTGTCAGCGCATGCACTCA Which two pairs of species are most likely to be most closely related?

In a hypothetical experiment, researchers sequence a gene from a colony of bacteria at various times in the history of the colony.In the common ancestor, the nucleotide at site 998 is A.After 1,500 generations, it changes to G.After 5,000 generations, it changes back to A.This is an example of a(n)

Refer to the figure showing the hypothetical observed sequences from two related species and their common ancestor. How many substitutions have actually occurred between species 1 and species 2?

Suppose that the size of a population of midges is 20 million and that the mutation rate of a neutral gene is 1.5 per million.How many new mutations of this gene should appear in the population per generation?

Which statement about genomes is true?

Suppose the size of a population of whales is 2,400 individuals.According to genetic drift theory, what is the probability that a newly arisen neutral mutation will become fixed in this population?

Which statement about the enzyme lysozyme is true?

Studying Life

Small Molecules and the Chemistry of Life

Proteins, Carbohydrates, and Lipids

Nucleic Acids and the Origin of Life

Cells: the Working Units of Life

Cell Membranes

Cell Communication and Multicellularity

Energy, Enzymes, and Metabolism

Pathways That Harvest Chemical Energy

Photosynthesis: Energy From Sunlight

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

Dna and Its Role in Heredity

From Dna to Protein: Gene Expression

Gene Mutation and Molecular Medicine

Regulation of Gene Expression

Genomes

Recombinant Dna and Biotechnology

Mechanisms of Evolution

Reconstructing and Using Phylogenies

Speciation

The History of Life on Earth

Bacteria, Archaea, and Viruses

The Origin and Diversification of Eukaryotes

Plants Without Seeds: From Water to Land

The Evolution of Seed Plants

The Evolution and Diversity of Fungi

Animal Origins and the Evolution of Body Plans

Protostome Animals

Deuterostome Animals

The Plant Body

Transport in Plants

Plant Nutrition

Regulation of Plant Growth

Reproduction in Flowering Plants

Plant Responses to Environmental Challenges

Physiology, Homeostasis, and Temperature Regulation

Animal Hormones

Immunology: Animal Defense Systems

Animal Reproduction

Animal Development

Neurons, Glia, and Nervous Systems

Sensory Systems

The Mammalian Nervous System: Structure and Higher Functions

Musculoskeletal Systems

Gas Exchange

Circulatory Systems

Nutrition, Digestion, and Absorption

Salt and Water Balance and Nitrogen Excretion

Animal Behavior

The Physical Environment and Biogeography of Life

Populations

Species Interactions

Communities

Ecosystems

A Changing Biosphere

Filters