Exam 23: Evolution of Genes and Genomes

Suppose the size of a population of marmots is 300.According to genetic drift theory, what is the probability that a newly arisen neutral mutation will become fixed in this population?

A mutation in a gene in which A is changed to G is called a _______, whereas a mutation of A to T is called a _______.The former type of mutation occurs at a _______ frequency than the latter.

Genes found in different species that diverge as a result of speciation are called _______, whereas genes in the same or different organisms that arise by gene duplication are called _______.

A missense substitution is the same as a _______ substitution.

Investigations of the mechanisms and consequences of the evolution of macromolecules make up the field of _______.

A similarity matrix gives us a measure of the _______ number of changes that have occurred during divergence between pairs of organisms.

Histones are proteins that play important roles in gene regulation.Between plants and animals, only two amino acid changes have occurred in the histone H4 protein, despite many synonymous changes.What can we infer from this observation?

Which model system for evolutionary research has a natural nucleotide substitution rate as high as 1 substitution per 1,000 nucleotides per generation?

Major influenza epidemics are typically triggered by _______ transmissions of the virus.

A sequence of DNA that arose from a gene duplication and is no longer functional is known as a(n) _______.

Within a genome, some genes are found to have multiple copies that cluster together and are very similar, both structurally and functionally.These genes tend to evolve in concert, and they are more closely related to each other than to orthologous genes of closely related species.Two different mechanisms appear to support concerted evolution.One mechanism is related to the pairing of homologous chromosomes that occurs during meiosis.Describe how this process works.

Refer to the figure showing the hypothetical observed sequences from two related species and their common ancestor. How many substitutions could be inferred from the sequence information given for species 1, species 2, and the common ancestor?

Consider a hypothetical enzyme-coding gene and sequences of the gene from several species of rodents.The figure shows the rates of nonsynonymous and synonymous substitutions for each of four regions of the gene. Which region is under the strongest purifying selection?

Refer to the figure. Genome size varies widely among different multicellular organisms.What is the greatest contributing cause of this variation?

Below are segments of DNA from three species of flies.Species 1 is the common ancestor of species 2 and species 3, and we have access to its DNA because it was preserved in amber. Species 1: AACTACTGCACGCTCATA Species 2: AACTAGTGCTCGCTCACA Species 3: AATTACTGCACGCTCACA Having access to Species 1, we can infer that there have been _______ substitutions from Species 1 to Species 2 and Species 3.Lacking access to Species 1, we could infer that there have been _______ substitutions between Species 2 and Species 3.

Refer to the table. Consider the first codon in the table, UUU.How many single nucleotide substitutions at any of the three positions are synonymous substitutions?

Below are the DNA sequences from four hypothetical species of bacteria. Species 1: AGAGAATCTGCCATGAACTGA Species 2: AGAGAGTCTGCGCATGCACTGA Species 3: AGAAAGTGTCAGCGGATGCACTCA Species 4: AGAAAGTGTCAGCGCATGCACTCA Align the sequences and construct a similarity matrix.Consider gaps of any length to be equivalent to two nucleotide differences.If two species share a gap, do not consider that a similarity.Write the similarities in the lower diagonal of the similarity matrix, and the differences in the upper diagonal.

The most likely reason that crickets (Laupala) have a larger genome size than fruit flies (Drosophila) is that crickets

Below are short fragments of DNA sequences from two yeast strains (A and B), which have been diverging from each other, as well as a short fragment from their common ancestor (C). Yeast A: TGACTGCAAACATCCTAG Yeast B: TGCCTGGACACATCGAAG Yeast C: TGCCTGGAAACCTCCTAG What is the minimum number of evolutionary changes that have occurred since strains A and B evolved from their common ancestor?

The table shows the amino acid sequences for an eight-residue section of a small protein for five different species (1-5). Which species differs from species 1 because of amino acid substitutions?