Exam 23: Evolution of Genes and Genomes

Refer to the figure. Based on the information provided in the phylogenetic gene tree, multiple gene duplication events followed by mutations have created _______ that consist(s) of JAK and TYK2 genes.

Biologists who are searching for a natural compound to improve corn yield are practicing _______.

A gene family that codes for various hormone receptors has been accumulating nucleotide substitutions at a rate of 0.4 substitutions per million years.On average, there have been 60 substitutions between the common ancestor of this gene family and each of the various living forms of this gene.Based on these numbers, this hormone receptor gene family likely originated _______ million years ago.

Compare in vitro evolution with molecular evolution in organisms.

In an experiment, researchers split a bacterial colony in two, allowing each of the new colonies to evolve separately.They then sequence a gene from colony 1 and colony 2.In the common ancestor, at nucleotide site 327 there is G.In colony 1, there is C; in colony 2, there is C.This is an example of a _______ substitution.

The genome of a eukaryotic organism is best defined as

Below are short fragments of DNA sequences from two yeast strains (A and B), which have been diverging from each other, as well as a short fragment from their common ancestor (C). Yeast A: TGACTGCAAACATCCTAG Yeast B: TGCCTGGACACATCGAAG Yeast C: TGCCTGGAAACCTCCTAG What is the minimum number of evolutionary changes that have occurred between the common ancestor and strain A?

Refer to the figure, which shows the process of in vitro evolution of a new RNA molecule. During which numbered step are mutations most likely to occur?

Biased gene conversion is a mechanism of

The developmental genes bicoid and zen are two distinct genes, with different functions, that were derived from a relatively old gene duplication.They are thus

A hypothetical human protein sequence is 161 amino acids long.The homologous sequence in chimpanzees is 160 amino acids long.Which modification would most likely be needed to align the sequences?

Which comparison procedure would tend to make it easier to obtain correct sequence alignments?

A group of homologous genes with related functions is known as a(n) _______.

How do bioprospecting and in vitro evolution differ?

Fossil, morphological, and molecular evidence shows that langurs and ruminants do not share a recent common ancestor.This is important with respect to lysozyme evolution, because it supports the hypothesis that the similar changes observed in the lysozyme sequence in both langurs and ruminants

Suppose three sibling species of frogs have the following DNA sequences at a portion of a gene: Species 1: AGTCTAGATCGCGGTCG Species 2: AGTCGATCGCGGACG Species 3: TGTCTAGATCACGGTCG Recall that the observed number of mutations can differ from the total number of actual substitutions that occurred in pairwise sequence comparisons.Which modification would align the three sequences so they could be used to make comparisons?

The following sequences were obtained from a hypothetical gene in three species of Drosophila: D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG How many differences have arisen between D.melanogaster and D.erecta sequences?

The enzyme _______ has evolved new functions in animals that perform foregut fermentation.

The genes that code for the enzyme lysozyme from a number of organisms whose diets comprise mostly leaves and grass were sequenced.Comparisons of the gene sequences revealed that

Recent studies in yeast and flies show that most duplicated genes are _______ (on an evolutionary scale), suggesting a(n) _______ rate of pseudogene formation.