Exam 23: Evolution of Genes and Genomes

The _______ technique permits comparison of sequences of amino acids in proteins or sequences of nucleotides in DNA, and it enables the detection of deletions and insertions in sequences that are being compared.

Two species of pine trees differ by a nucleotide substitution in the coding region of a gene, but the proteins produced by this gene are the same in both species.This substitution is thus a _______ substitution.

Which general principle of molecular evolution can you most reasonably infer?

Refer to the table Consider the codon UUA.Which of the following codons is representative of one or more synonymous substitution(s)?

The following sequences have been obtained from a hypothetical gene in three species of Drosophila: D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG If we assume that each observed substitution is equivalent to 2 nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.

Noncoding DNA takes up a small proportion of the genomes of _______, which tend to have _______ population sizes.

Depictions of lateral gene transfer events on the underlying species tree are known as

The sickness whooping cough is caused by infection with the bacterium Bordetella pertussis, which produces pertussis toxin.This toxin inhibits the activity of a protein that regulates adenylyl cyclase.One symptom of this inhibition is the development of a severe cough that can be so strong that it breaks ribs.Vaccines for B.pertussis are effective, but the bacterium can develop sequence differences that allow it to escape detection by the immune system.To develop an updated vaccine that confers immunity to a new strain of B.pertussis, researchers would

The number of actual substitutions that have occurred between diverging lineages in a sequence will usually be _______ than the number of substitutions observed when sequences are compared, and this discrepancy should _______ with increasing evolutionary divergence.

In an experiment, researchers split a bacterial colony in two, allowing each of the new colonies to evolve separately.They then sequence a gene from colony 1 and colony 2.In the common ancestor, at nucleotide site 167 there is T.In colony 1, there is C; in colony 2, there is T.This is an example of a _______ substitution.

A molecular evolutionist is collaborating with a researcher who wants to develop antibiotics that specifically bind to certain proteins on pathogenic chlamydia bacteria without harming beneficial bacteria in the host animal gut.The molecular evolutionary research approach that would best aid this project would be to investigate

The best way to detect whether lateral gene transfer has occurred would be by

The mutation rate of a gene in a species of minnows is 2 per million nucleotides per generation.Only 25 percent of the mutations of this gene are selectively neutral; the rest are deleterious.What is the substitution rate of this gene (per million nucleotides per generation)?

In an experiment, researchers split a bacterial colony in two, allowing each of the new colonies to evolve separately.They then sequence a gene from colony 1 and colony 2.In the common ancestor, at nucleotide site 56 there is A.In colony 1, there is C; in colony 2, there is T.This is an example of a _______ substitution.

The primary use of in vitro evolution is to

In which order would a molecular evolutionist perform the following tasks: (1) construct a similarity matrix, (2) align the sequences, and (3) use a model of evolution to correct for multiple substitutions and other factors?

Below are short fragments of DNA sequences from two yeast strains (A and B), which have been diverging from each other, as well as a short fragment from their common ancestor (C). Yeast A: TGACTGCAAACATCCTAG Yeast B: TGCCTGGACACATCGAAG Yeast C: TGCCTGGAAACCTCCTAG Lacking information from the common ancestor, what would you conclude is the minimum number of evolutionary changes occurring between strains A and B?

Based on what you have learned about evolutionary processes, what modifications could you introduce into in vitro evolution experiments (such as the one shown in Figure 23.13) to increase the diversity or rate of evolution of new molecules?

A reversion is also known as a _______ substitution.

Respiratory syncytial virus (RSV) is a human-specific virus that causes infections of the lungs and respiratory tract and commonly infects infants and young children.In the young and immunosuppressed it can cause bronchiolitis and pneumonia.There are multiple strains of RSV, which has made it difficult to develop a protective vaccine.To better understand the evolution of different RSV strains, scientists should