Question 1

Which event is likely to affect the length of arrays of repetitive sequences?

Accepted Answer

A)  Biased gene conversion 
B)  Unequal crossing over 
C)  Lateral gene transfer 
D)  Nonsynonymous nucleotide substitutions 
E)  Synonymous nucleotide substitutions 
A)  Biased gene conversion 
B)  Unequal crossing over 
C)  Lateral gene transfer 
D)  Nonsynonymous nucleotide substitutions 
E)  Synonymous nucleotide substitutions

Question 2

Though they look quite different, because of evolved modifications, the limbs of whales, bats, and humans are all derived from the same structure present in the common ancestor of these mammals.Thus, these limbs are _______ structures.

Accepted Answer

A)  analogous 
B)  aligned 
C)  homologous 
D)  coincident 
E)  paralogous 
A)  analogous 
B)  aligned 
C)  homologous 
D)  coincident 
E)  paralogous

Question 3

When comparing the amino acid sequences of homologous proteins, molecular evolutionists can construct a _______ by summing the numbers of the same or different amino acids in each pair of compared sequences.

Accepted Answer

The answer of When comparing the amino acid sequences of...

Question 4

The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
If we assume that each observed nucleotide change is equivalent to two nucleotide substitutions, a total of _______ substitution(s) has/have occurred between D.melanogaster and D.simulans.

Accepted Answer

The answer of The following sequences have been obtained from...

Question 5

The hypothesis for genome size presented in the textbook proposes that _______ selection is _______ effective in large populations, and thus species with large populations should have _______ genomes than those with smaller populations.

Accepted Answer

A)  positive; more; larger 
B)  positive; less; smaller 
C)  purifying; more; larger 
D)  purifying; more; smaller 
E)  purifying; less; larger 
A)  positive; more; larger 
B)  positive; less; smaller 
C)  purifying; more; larger 
D)  purifying; more; smaller 
E)  purifying; less; larger

Question 6

Which statement about pseudogenes is false?

Accepted Answer

A)  They are nonfunctional copies of genes. 
B)  They evolve faster than synonymous substitutions. 
C)  They evolve faster than nonsynonymous substitutions. 
D)  They are functional copies of genes. 
E)  They can evolve to become functional paralogs. 
A)  They are nonfunctional copies of genes. 
B)  They evolve faster than synonymous substitutions. 
C)  They evolve faster than nonsynonymous substitutions. 
D)  They are functional copies of genes. 
E)  They can evolve to become functional paralogs.

Question 7

Paralogous genes are genes that trace back to a common _______ event.

Accepted Answer

The answer of Paralogous genes are genes that trace back...

Question 8

The primary function of ribosomal RNA gene products is

Accepted Answer

A)  to carry oxygen. 
B)  protein synthesis. 
C)  DNA preservation. 
D)  to act as transcription factors regulating development. 
E)  lateral gene transfer. 
A)  to carry oxygen. 
B)  protein synthesis. 
C)  DNA preservation. 
D)  to act as transcription factors regulating development. 
E)  lateral gene transfer.

Question 9

The natural substitution rate for the RNA virus HIV-1 is 1 substitution per 1,000 nucleotides per generation.Consequently, this virus can be used as a model system to directly study molecular _______.

Accepted Answer

The answer of The natural substitution rate for the RNA...

Question 10

Which statement about molecular evolution is true?

Accepted Answer

A)  Almost all genes evolve at the same rate. 
B)  All nucleotide substitutions give rise to amino acid replacements. 
C)  Changes in the amino acid sequence of a protein can change its charge but not its secondary structure. 
D)  Molecular evolution generates biological diversity. 
E)  Molecular evolution does not account for genetic variation. 
A)  Almost all genes evolve at the same rate. 
B)  All nucleotide substitutions give rise to amino acid replacements. 
C)  Changes in the amino acid sequence of a protein can change its charge but not its secondary structure. 
D)  Molecular evolution generates biological diversity. 
E)  Molecular evolution does not account for genetic variation.

Question 11

Molecular evolutionists study relationships between the _______ of genes and proteins and their functions in organisms.

Accepted Answer

The answer of Molecular evolutionists study relationships between the _______...

Question 12

Which statement about gene duplication is false?

Accepted Answer

A)  All duplications produce functional genes. 
B)  It can result in evolution of novel functions in proteins. 
C)  It created much of the diversity in our genome. 
D)  Ribosomal RNA genes arose from duplications. 
E)  It can result in increased complexity. 
A)  All duplications produce functional genes. 
B)  It can result in evolution of novel functions in proteins. 
C)  It created much of the diversity in our genome. 
D)  Ribosomal RNA genes arose from duplications. 
E)  It can result in increased complexity.

Question 13

The following sequences have been obtained from a hypothetical gene in three species of Drosophila:
D.melanogaster: GGCTTGTAGCTGTGCTCGCCGCTAGTCGG
D.simulans: AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
D.erecta: AGGGTAGCTGTGCTCACCGCTCGTCGG
To properly align the three sequences so they can be used to make comparisons, a gap representing _______ nucleotides should be added to sequence D.erecta starting at position 4.

Accepted Answer

The answer of The following sequences have been obtained from...

Question 14

As discussed in the text, the molecular evolution studies of sodium channels in puffer fish are primarily used

Accepted Answer

A)  to produce new molecules by in vitro evolution. 
B)  as an example of bioprospecting. 
C)  to study protein function. 
D)  to determine the evolutionary history of gene families. 
E)  to combat disease. 
A)  to produce new molecules by in vitro evolution. 
B)  as an example of bioprospecting. 
C)  to study protein function. 
D)  to determine the evolutionary history of gene families. 
E)  to combat disease.

Question 15

Refer to the figure.   Which of the nucleotide substitutions in an mRNA strand would have the most harmful effect on the activity of the protein that it encodes?

Accepted Answer

A)  GGU to GGC 
B)  GGA to UGA 
C)  GGA to GGG 
D)  GGU to GGG 
E)  CGA to AGG 
A)  GGU to GGC 
B)  GGA to UGA 
C)  GGA to GGG 
D)  GGU to GGG 
E)  CGA to AGG

Question 16

Suppose the common ancestor of cows and whales had A at one nucleotide site.At this site, whales have G and cows have T.This would be an example of a _______ substitution.

Accepted Answer

The answer of Suppose the common ancestor of cows and...

Question 17

Suppose the size of a population of marmots is 300.Assuming that the neutral mutation rate for a particular gene is µ (mu), the number of new mutations at each gene in this population is _______ × µ.

Accepted Answer

A)  100 
B)  200 
C)  300 
D)  500 
E)  600 
A)  100 
B)  200 
C)  300 
D)  500 
E)  600

Question 18

Scientists use sequence alignment to identify _______ nucleotides or amino acids when studying the evolution of genes shared by two or more species with a common ancestor.

Accepted Answer

The answer of Scientists use sequence alignment to identify _______...

Question 19

The central hypothesis of the neutral theory asserts that

Accepted Answer

A)  the rate of molecular mutation is influenced by natural selection. 
B)  most variability in the structure of molecules does not affect the functioning of the organism. 
C)  closely related species have more similar molecular structures than do distantly related species. 
D)  nearly all mutations are neutral. 
E)  mutations neither add amino acids to molecules nor subtract from them. 
A)  the rate of molecular mutation is influenced by natural selection. 
B)  most variability in the structure of molecules does not affect the functioning of the organism. 
C)  closely related species have more similar molecular structures than do distantly related species. 
D)  nearly all mutations are neutral. 
E)  mutations neither add amino acids to molecules nor subtract from them.

Question 20

In which organism would you find the enzyme lysozyme?

Accepted Answer

A)  Only in foregut fermenters 
B)  Only in the hoatzin 
C)  Only in foregut fermenters and the hoatzin 
D)  Only in mammals and a few closely related organisms 
E)  In nearly all animals 
A)  Only in foregut fermenters 
B)  Only in the hoatzin 
C)  Only in foregut fermenters and the hoatzin 
D)  Only in mammals and a few closely related organisms 
E)  In nearly all animals

Exam 23: Evolution of Genes and Genomes

Which event is likely to affect the length of arrays of repetitive sequences?

Though they look quite different, because of evolved modifications, the limbs of whales, bats, and humans are all derived from the same structure present in the common ancestor of these mammals.Thus, these limbs are _______ structures.

When comparing the amino acid sequences of homologous proteins, molecular evolutionists can construct a _______ by summing the numbers of the same or different amino acids in each pair of compared sequences.

The hypothesis for genome size presented in the textbook proposes that _______ selection is _______ effective in large populations, and thus species with large populations should have _______ genomes than those with smaller populations.

Which statement about pseudogenes is false?

Paralogous genes are genes that trace back to a common _______ event.

The primary function of ribosomal RNA gene products is

The natural substitution rate for the RNA virus HIV-1 is 1 substitution per 1,000 nucleotides per generation.Consequently, this virus can be used as a model system to directly study molecular _______.

Which statement about molecular evolution is true?

Molecular evolutionists study relationships between the _______ of genes and proteins and their functions in organisms.

Which statement about gene duplication is false?

As discussed in the text, the molecular evolution studies of sodium channels in puffer fish are primarily used

Refer to the figure. Which of the nucleotide substitutions in an mRNA strand would have the most harmful effect on the activity of the protein that it encodes?

Suppose the common ancestor of cows and whales had A at one nucleotide site.At this site, whales have G and cows have T.This would be an example of a _______ substitution.

Suppose the size of a population of marmots is 300.Assuming that the neutral mutation rate for a particular gene is µ (mu), the number of new mutations at each gene in this population is _______ × µ.

Scientists use sequence alignment to identify _______ nucleotides or amino acids when studying the evolution of genes shared by two or more species with a common ancestor.

The central hypothesis of the neutral theory asserts that

In which organism would you find the enzyme lysozyme?

Studying Life

Small Molecules and the Chemistry of Life

Proteins, Carbohydrates, and Lipids

Nucleic Acids and the Origin of Life

Cells: the Working Units of Life

Cell Membranes

Cell Communication and Multicellularity

Energy, Enzymes, and Metabolism

Pathways That Harvest Chemical Energy

Photosynthesis: Energy From Sunlight

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

Dna and Its Role in Heredity

From Dna to Protein: Gene Expression

Gene Mutation and Molecular Medicine

Regulation of Gene Expression

Genomes

Recombinant Dna and Biotechnology

Mechanisms of Evolution

Reconstructing and Using Phylogenies

Speciation

The History of Life on Earth

Bacteria, Archaea, and Viruses

The Origin and Diversification of Eukaryotes

Plants Without Seeds: From Water to Land

The Evolution of Seed Plants

The Evolution and Diversity of Fungi

Animal Origins and the Evolution of Body Plans

Protostome Animals

Deuterostome Animals

The Plant Body

Transport in Plants

Plant Nutrition

Regulation of Plant Growth

Reproduction in Flowering Plants

Plant Responses to Environmental Challenges

Physiology, Homeostasis, and Temperature Regulation

Animal Hormones

Immunology: Animal Defense Systems

Animal Reproduction

Animal Development

Neurons, Glia, and Nervous Systems

Sensory Systems

The Mammalian Nervous System: Structure and Higher Functions

Musculoskeletal Systems

Gas Exchange

Circulatory Systems

Nutrition, Digestion, and Absorption

Salt and Water Balance and Nitrogen Excretion

Animal Behavior

The Physical Environment and Biogeography of Life

Populations

Species Interactions

Communities

Ecosystems

A Changing Biosphere

Filters

The hypothesis for genome size presented in the textbook proposes that ___ selection is _ effective in large populations, and thus species with large populations should have _____ genomes than those with smaller populations.