Question 1

DNA from one organism will not bond to DNA from another organism.

Accepted Answer

A) True 
 B)False  False

Question 2

The genes for the normal and sickle cell anemia alleles of hemoglobin are cut with the restriction enzyme DdeI. The resulting DNA fragments were separated by gel electrophoresis, producing the gel shown in the figure below.  
Why are the patterns produced by these two alleles different?

Accepted Answer

A)  The normal hemoglobin gene is cut by two restriction enzymes, but the sickle cell anemia allele is cut by only one restriction enzyme. 
B)  The gene for the normal allele is much larger than the gene for sickle cell anemia. 
C)  The gene for the normal allele has a sequence recognized by DdeI, but the gene for sickle cell anemia does not. 
D)  The sickle cell allele has the ability to produce ligase to repair the damage done by restriction enzymes, but the normal allele does not. 
A)  The normal hemoglobin gene is cut by two restriction enzymes, but the sickle cell anemia allele is cut by only one restriction enzyme. 
B)  The gene for the normal allele is much larger than the gene for sickle cell anemia. 
C)  The gene for the normal allele has a sequence recognized by DdeI, but the gene for sickle cell anemia does not. 
D)  The sickle cell allele has the ability to produce ligase to repair the damage done by restriction enzymes, but the normal allele does not. C

Question 3

A restriction enzyme cuts DNA into fragments

Accepted Answer

A)  whenever the correct ligase is present. 
B)  only in laboratory conditions. 
C)  only in the organism that produces it. 
D)  when mixed with the DNA that contains the target DNA sequence. 
A)  whenever the correct ligase is present. 
B)  only in laboratory conditions. 
C)  only in the organism that produces it. 
D)  when mixed with the DNA that contains the target DNA sequence. D

Question 4

The immune disorder adenosine deaminase (ADA) deficiency, is the result of a mutation in one gene. How could gene therapy be used to treat this disorder?

Accepted Answer

A)  Red blood cells could be induced to produce the protein encoded by the mutated ADA gene. 
B)  Cells containing a corrected ADA gene could be injected into patients with ADA. 
C)  Synthetic blood cells could be swallowed by the patients. 
D)  Patients could be injected with a hybrid molecule made of the DNA and RNA of the normal ADA gene. 
A)  Red blood cells could be induced to produce the protein encoded by the mutated ADA gene. 
B)  Cells containing a corrected ADA gene could be injected into patients with ADA. 
C)  Synthetic blood cells could be swallowed by the patients. 
D)  Patients could be injected with a hybrid molecule made of the DNA and RNA of the normal ADA gene.

Question 5

Ligases are used to

Accepted Answer

A)  connect two DNA fragments to each other. 
B)  snip DNA into smaller molecules. 
C)  separate DNA molecules by size. 
D)  determine the exact base sequence of a DNA molecule. 
A)  connect two DNA fragments to each other. 
B)  snip DNA into smaller molecules. 
C)  separate DNA molecules by size. 
D)  determine the exact base sequence of a DNA molecule.

Question 6

Deliberately transferring a gene from one species to another is an example of

Accepted Answer

A)  constructing a gene library. 
B)  genetic engineering. 
C)  the polymerase chain reaction. 
D)  cloning. 
A)  constructing a gene library. 
B)  genetic engineering. 
C)  the polymerase chain reaction. 
D)  cloning.

Question 7

The poplar, a type of tree, does not produce flowers until it is eight years old. How does this characteristic make the poplar a good candidate for genetic engineering?

Accepted Answer

A)  The slow growth rate of poplars makes it easier for every cell of a tree to be genetically modified with a gene gun. 
B)  Plants reject recombinant DNA when they start reproducing. The longer than normal maturation time of poplars extends the usefulness of the plant in processes like bioremdiation. 
C)  Plants do not begin producing the gene products of recombinant DNA until after they mature and begin reproducing. The shorter than normal maturation time of poplars allows them to become useful faster. 
D)  It is easy to prevent poplars from spreading recombinant DNA to wild tree populations since you can cut them down before they start reproducing. 
A)  The slow growth rate of poplars makes it easier for every cell of a tree to be genetically modified with a gene gun. 
B)  Plants reject recombinant DNA when they start reproducing. The longer than normal maturation time of poplars extends the usefulness of the plant in processes like bioremdiation. 
C)  Plants do not begin producing the gene products of recombinant DNA until after they mature and begin reproducing. The shorter than normal maturation time of poplars allows them to become useful faster. 
D)  It is easy to prevent poplars from spreading recombinant DNA to wild tree populations since you can cut them down before they start reproducing.

Question 8

Cloning and sequencing are important in the study of inherited diseases, because

Accepted Answer

A)  many copies of the gene can be ligated. 
B)  the protein product that produces the disease can be determined. 
C)  the process can be reversed to cure the disease. 
D)  the clones can be easily paired. 
A)  many copies of the gene can be ligated. 
B)  the protein product that produces the disease can be determined. 
C)  the process can be reversed to cure the disease. 
D)  the clones can be easily paired.

Question 9

Gel electrophoresis is used to

Accepted Answer

A)  connect two DNA fragments to each other. 
B)  snip DNA into smaller molecules. 
C)  separate DNA molecules by size. 
D)  determine the exact base sequence of a DNA molecule. 
A)  connect two DNA fragments to each other. 
B)  snip DNA into smaller molecules. 
C)  separate DNA molecules by size. 
D)  determine the exact base sequence of a DNA molecule.

Question 10

In RFLP analysis, which regions of DNA would provide the strongest evidence of a genetic relationship?

Accepted Answer

A)  regions with noncoding and spacer DNA 
B)  regions that contain the genes for hemoglobin 
C)  regions that might contain genes related to personality disorders 
D)  regions that can be easily fragmented 
A)  regions with noncoding and spacer DNA 
B)  regions that contain the genes for hemoglobin 
C)  regions that might contain genes related to personality disorders 
D)  regions that can be easily fragmented

Question 11

Because the ____________ regions of DNA show the highest level of variation between individuals, they are most commonly analyzed during DNA fingerprinting.

Accepted Answer

The answer of Because the ____________ regions of DNA show...

Question 12

Genetic engineering has been used to mass-produce insulin for diabetics.

Accepted Answer

A) True 
 B)False

Question 13

The most efficient method of determining the base sequence of a piece of DNA is to

Accepted Answer

A)  insert the ligase gene. 
B)  expose it to radioactivity. 
C)  use an automated sequencing machine. 
D)  hand-count the base pairs. 
A)  insert the ligase gene. 
B)  expose it to radioactivity. 
C)  use an automated sequencing machine. 
D)  hand-count the base pairs.

Question 14

You are shown the following result of gel electrophoresis in the figure below.  
Column 1 represents blood found on the arm of a crime victim, but is not the victim's blood. The other columns are blood taken from various suspects. Which suspect is most likely the guilty one?

Accepted Answer

A)  2 
B)  3 
C)  4 
D)  5 
A)  2 
B)  3 
C)  4 
D)  5

Question 15

Cloning is useful because it

Accepted Answer

A)  repairs broken DNA. 
B)  mixes the DNA from two different organisms. 
C)  produces many copies of a gene. 
D)  determines the base sequence of a gene. 
A)  repairs broken DNA. 
B)  mixes the DNA from two different organisms. 
C)  produces many copies of a gene. 
D)  determines the base sequence of a gene.

Question 16

A DNA _______ that binds to a certain sequence can be used to test for the presence of an allele or gene.

Accepted Answer

The answer of A DNA _______ that binds to a...

Question 17

Restriction enzymes work only on bacterial DNA.

Accepted Answer

A) True 
 B)False

Question 18

A DNA _______ is a collection of one organism's DNA fragments that are stored in another organism.

Accepted Answer

The answer of A DNA _______ is a collection of...

Question 19

The polymerase chain reaction (PCR) technique could be developed only after the discovery of bacterial enzymes that were able to withstand high temperatures. Why was it necessary to use such enzymes?

Accepted Answer

A)  Only bacterial DNA can be copied using the PCR method, so bacterial enzymes were necessary. 
B)  Bacterial enzymes can only move through the gel during PCR electrophoresis. 
C)  DNA can only be cut into fragments at high temperatures. 
D)  The temperature required to separate DNA strands during PCR degrades most normal enzymes. 
A)  Only bacterial DNA can be copied using the PCR method, so bacterial enzymes were necessary. 
B)  Bacterial enzymes can only move through the gel during PCR electrophoresis. 
C)  DNA can only be cut into fragments at high temperatures. 
D)  The temperature required to separate DNA strands during PCR degrades most normal enzymes.

Question 20

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. What sequences of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

Accepted Answer

AGTTTCGAGAGCGGATGCCC and GGGCC

Exam 15: DNA Technology

DNA from one organism will not bond to DNA from another organism.

The genes for the normal and sickle cell anemia alleles of hemoglobin are cut with the restriction enzyme DdeI. The resulting DNA fragments were separated by gel electrophoresis, producing the gel shown in the figure below. Why are the patterns produced by these two alleles different?

A restriction enzyme cuts DNA into fragments

The immune disorder adenosine deaminase (ADA) deficiency, is the result of a mutation in one gene. How could gene therapy be used to treat this disorder?

Ligases are used to

Deliberately transferring a gene from one species to another is an example of

The poplar, a type of tree, does not produce flowers until it is eight years old. How does this characteristic make the poplar a good candidate for genetic engineering?

Cloning and sequencing are important in the study of inherited diseases, because

Gel electrophoresis is used to

In RFLP analysis, which regions of DNA would provide the strongest evidence of a genetic relationship?

Because the ____________ regions of DNA show the highest level of variation between individuals, they are most commonly analyzed during DNA fingerprinting.

Genetic engineering has been used to mass-produce insulin for diabetics.

The most efficient method of determining the base sequence of a piece of DNA is to

You are shown the following result of gel electrophoresis in the figure below. Column 1 represents blood found on the arm of a crime victim, but is not the victim's blood. The other columns are blood taken from various suspects. Which suspect is most likely the guilty one?

Cloning is useful because it

A DNA _______ that binds to a certain sequence can be used to test for the presence of an allele or gene.

Restriction enzymes work only on bacterial DNA.

A DNA _______ is a collection of one organism's DNA fragments that are stored in another organism.

The polymerase chain reaction (PCR) technique could be developed only after the discovery of bacterial enzymes that were able to withstand high temperatures. Why was it necessary to use such enzymes?

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. What sequences of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

The Nature of Science and the Characteristics of Life

Organizing the Diversity of Life

Major Groups of Living Organisms

Chemical Building Blocks

Cell Structure and Internal Compartments

Cell Membranes, Transport, and Communication

Energy and Enzymes

Photosynthesis and Cellular Respiration

Cell Division

Patterns of Inheritance

Chromosomes and Human Genetics

DNA

From Gene to Protein

Control of Gene Expression

How Evolution Works

Evolution of Populations

Adaptation and Speciation

The Evolutionary History of Life

Maintaining the Internal Environment

Animal Nutrition and Digestion

Gas Exchange

The Circulatory System

Animal Hormones

The Nervous System

Sensing the Environment

Skeletons, Muscles, and Movement

Defenses against Disease

Reproduction and Development

Animal Behavior

Plant Structure, Nutrition, and Transport

Plant Growth and Reproduction

The Biosphere

Growth of Populations

Interactions among Organisms

Communities of Organisms

Ecosystems

Global Change

Biodiversity and People

Cancer: Cell Division Out of Control

Harnessing the Human Genome

Humans and Evolution

Smoking--Beyond Lung Cancer

Feeding a Hungry Planet

Building a Sustainable Society

Filters