Question 1

The precursors to the genes that cause the electric discharges in the electric organs of some fish evolved from _______ genes that were involved in _______.

Accepted Answer

A)  calcium channel; muscle contraction 
B)  calcium channel; neuronal activity 
C)  sodium channel; muscle contraction 
D)  sodium channel; neuronal activity 
E)  NMDA channel; neuronal activity 
A)  calcium channel; muscle contraction 
B)  calcium channel; neuronal activity 
C)  sodium channel; muscle contraction 
D)  sodium channel; neuronal activity 
E)  NMDA channel; neuronal activity

Question 2

Which of the following changes is a transversion?

Accepted Answer

A)  A change from A to G 
B)  A change from C to T 
C)  A change from G to A 
D)  All of the above 
E)  None of the above 
A)  A change from A to G 
B)  A change from C to T 
C)  A change from G to A 
D)  All of the above 
E)  None of the above

Question 3

Which of the following statements about molecular evolution is true?

Accepted Answer

A)  Almost all genes evolve at the same rate. 
B)  All nucleotide substitutions give rise to amino acid replacements. 
C)  Changes in the amino acid sequence of a protein can change its charge, but not its secondary structure. 
D)  All of the above 
E)  None of the above 
A)  Almost all genes evolve at the same rate. 
B)  All nucleotide substitutions give rise to amino acid replacements. 
C)  Changes in the amino acid sequence of a protein can change its charge, but not its secondary structure. 
D)  All of the above 
E)  None of the above

Question 4

Regions of a DNA sequence that are invariant across diverse animals are most likely

Accepted Answer

A)  subject to transversions. 
B)  under strong stabilizing selection. 
C)  incapable of alignment. 
D)  pseudogenes. 
E)  undergoing silent substitutions. 
A)  subject to transversions. 
B)  under strong stabilizing selection. 
C)  incapable of alignment. 
D)  pseudogenes. 
E)  undergoing silent substitutions.

Question 5

The hands of humans and the wings of bats are derived from a structure possessed by the common ancestor of both. Human hands and bat wings are thus _______ structures.

Accepted Answer

The answer of The hands of humans and the wings...

Question 6

Which of the following statements is correct?

Accepted Answer

A)  All orthologs are paralogs. 
B)  All paralogs are orthologs. 
C)  All orthologs are homologs. 
D)  All homologs are orthologs. 
E)  None of the above 
A)  All orthologs are paralogs. 
B)  All paralogs are orthologs. 
C)  All orthologs are homologs. 
D)  All homologs are orthologs. 
E)  None of the above

Question 7

Which of the following statements about gene families is false?

Accepted Answer

A)  Gene families evolve via gene duplication. 
B)  Pseudogenes are quickly removed from gene families by deletion. 
C)  Members of a gene family can include several functional genes. 
D)  Examples of gene families include the engrailed and globin gene families in vertebrates. 
E)  In some gene families, the members do not evolve independently of one another. 
A)  Gene families evolve via gene duplication. 
B)  Pseudogenes are quickly removed from gene families by deletion. 
C)  Members of a gene family can include several functional genes. 
D)  Examples of gene families include the engrailed and globin gene families in vertebrates. 
E)  In some gene families, the members do not evolve independently of one another.

Question 8

Orthologous genes are genes that can be traced back to a common _______ event.

Accepted Answer

A)  duplication 
B)  substitution 
C)  speciation 
D)  deletion 
E)  duplication and speciation 
A)  duplication 
B)  substitution 
C)  speciation 
D)  deletion 
E)  duplication and speciation

Question 9

Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How many substitutions have occurred between D. melanogaster and D. simulans?

Accepted Answer

One (the C

Question 10

If one is interested in reconstructing the evolutionary history of species of birds, which of the following should be considered in the analysis?

Accepted Answer

A)  Orthologs 
B)  Paralogs 
C)  Perilogs 
D)  Metalogs 
E)  Both a and b 
A)  Orthologs 
B)  Paralogs 
C)  Perilogs 
D)  Metalogs 
E)  Both a and b

Question 11

Use the following to answer questions :
Sequences of a hypothetical gene that codes for an enzyme were obtained from several species of rodents. Refer to the diagram below, showing the rate of nonsynonymous and synonymous substitutions for each of four regions of the gene.  
-Which region is under the strongest stabilizing ­selection?

Accepted Answer

The answer of Use the following to answer questions :
Sequences...

Question 12

Which of the following is not true of concerted evolution?

Accepted Answer

A)  Concerted evolution refers to the nonindependent evolution of some repeated genes within a species. 
B)  Unequal crossing over may produce concerted evolution. 
C)  Biased gene conversion may produce concerted evolution. 
D)  Ribosomal RNA genes are an example of a gene family that has undergone concerted evolution. 
E)  Concerted evolution results in divergence of members of a gene family within an organism. 
A)  Concerted evolution refers to the nonindependent evolution of some repeated genes within a species. 
B)  Unequal crossing over may produce concerted evolution. 
C)  Biased gene conversion may produce concerted evolution. 
D)  Ribosomal RNA genes are an example of a gene family that has undergone concerted evolution. 
E)  Concerted evolution results in divergence of members of a gene family within an organism.

Question 13

The developmental genes bicoid and zen are derived from a relatively old gene duplication. They are thus _______.

Accepted Answer

The answer of The developmental genes bicoid and zen are...

Question 14

Which of the following statements about the globin gene family is false?

Accepted Answer

A)  Hemoglobin has a higher affinity for oxygen than myoglobin has. 
B)  Myoglobin is the primary oxygen storage molecule in the muscles. 
C)  Hemoglobin and myoglobin have evolved to have somewhat different functions. 
D)  Hemoglobin has a tetrameric structure that allows it to carry more oxygen molecules than does ­myoglobin. 
E)  All of the above are true; none is false. 
A)  Hemoglobin has a higher affinity for oxygen than myoglobin has. 
B)  Myoglobin is the primary oxygen storage molecule in the muscles. 
C)  Hemoglobin and myoglobin have evolved to have somewhat different functions. 
D)  Hemoglobin has a tetrameric structure that allows it to carry more oxygen molecules than does ­myoglobin. 
E)  All of the above are true; none is false.

Question 15

Biologists who are searching for a natural compound to improve corn yield are practicing _______.

Accepted Answer

The answer of Biologists who are searching for a natural...

Question 16

Suppose the ancestral nucleotide at position 786 is A, and the same substitution from A to G occurs in both descendant lineages. This substitution would be called a _______ substitution.

Accepted Answer

The answer of Suppose the ancestral nucleotide at position 786...

Question 17

Nonindependent evolution of some repeated genes within a species

Accepted Answer

A)  is called concerted evolution. 
B)  can be caused by biased gene conversion. 
C)  can be caused by unequal crossing over. 
D)  Both a and c 
E)  All of the above 
A)  is called concerted evolution. 
B)  can be caused by biased gene conversion. 
C)  can be caused by unequal crossing over. 
D)  Both a and c 
E)  All of the above

Question 18

Which of the following statements about genomes is true?

Accepted Answer

A)  The variation in genome size among animals is greater than the variation in the number of genes. 
B)  The variation in genome size among animals is less than the variation in the number of genes. 
C)  Most of the DNA in humans codes for proteins. 
D)  Both a and c 
E)  Both b and c 
A)  The variation in genome size among animals is greater than the variation in the number of genes. 
B)  The variation in genome size among animals is less than the variation in the number of genes. 
C)  Most of the DNA in humans codes for proteins. 
D)  Both a and c 
E)  Both b and c

Question 19

Models of nucleotide sequence evolution, developed by biologists to estimate sequence divergence, include parameters that account for

Accepted Answer

A)  substitution rates between different nucleotides. 
B)  differences in substitution rates across different positions in a gene. 
C)  differences in nucleotide frequencies. 
D)  All of the above 
E)  None of the above 
A)  substitution rates between different nucleotides. 
B)  differences in substitution rates across different positions in a gene. 
C)  differences in nucleotide frequencies. 
D)  All of the above 
E)  None of the above

Question 20

A sequence of DNA that arose from a gene duplication and is no longer functional is known as a _______.

Accepted Answer

The answer of A sequence of DNA that arose from...

Exam 24: Evolution of Genes and Genomes

The precursors to the genes that cause the electric discharges in the electric organs of some fish evolved from _______ genes that were involved in _______.

Which of the following changes is a transversion?

Which of the following statements about molecular evolution is true?

Regions of a DNA sequence that are invariant across diverse animals are most likely

The hands of humans and the wings of bats are derived from a structure possessed by the common ancestor of both. Human hands and bat wings are thus _______ structures.

Which of the following statements is correct?

Which of the following statements about gene families is false?

Orthologous genes are genes that can be traced back to a common _______ event.

If one is interested in reconstructing the evolutionary history of species of birds, which of the following should be considered in the analysis?

Which of the following is not true of concerted evolution?

The developmental genes bicoid and zen are derived from a relatively old gene duplication. They are thus _______.

Which of the following statements about the globin gene family is false?

Biologists who are searching for a natural compound to improve corn yield are practicing _______.

Suppose the ancestral nucleotide at position 786 is A, and the same substitution from A to G occurs in both descendant lineages. This substitution would be called a _______ substitution.

Nonindependent evolution of some repeated genes within a species

Which of the following statements about genomes is true?

Models of nucleotide sequence evolution, developed by biologists to estimate sequence divergence, include parameters that account for

A sequence of DNA that arose from a gene duplication and is no longer functional is known as a _______.

Studying Life

Small Molecules and the Chemistry of Life

Proteins, Carbohydrates, and Lipids

Nucleic Acids and the Origin of Life

Cells: the Working Units of Life

Cell Membranes

Cell Signaling and Communication

Energy, Enzymes, and Metabolism

Pathways That Harvest Chemical Energy

Photosynthesis: Energy From Sunlight

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

Dna and Its Role in Heredity

From Dna to Protein: Gene Expression

Gene Mutation and Molecular Medicine

Regulation of Gene Expression

Genomes

Recombinent Dna and Biotechnology

Differential Gene Expression in Development

Development and Evolutionary Change

Evidence and Mechanisms of Evolution

Reconstructing and Using Phylogenies

Species and Their Formation

The History of Life on Earth

Bacteria and Archaea: the Prokaryotic Domains

The Origin and Diversification of Eukaryotes

Plants Without Seeds: From Water to Land

The Evolution of Seed Plants

Fungi: Recyclers, Pathogens, Parasites, and Plant Partners

Animal Origins and the Evolution of Body Plans

Protostome Animals

Deuterostome Animals

The Plant Body

Transport in Plants

Plant Nutrition

Regulation of Plant Growth

Reproduction in Flowering Plants

Plant Responses to Environmental Challenges

Physiology, Homeostasis, and Temperature Regulation

Animal Hormones

Immunology: Animal Defense Systems

Animal Reproduction

Animal Development

Neurons and Nervous Systems

Sensory Systems

The Mammalian Nervous System: Structure and Higher Function

Musculoskeletal Systems

Gas Exchange in Animals

Circulatory Systems

Nutrition, Digestion, and Absorption

Salt and Water Balance and Nitrogen

Animal Behavior

Ecology and the Distribution of Life

Population Ecology

Species Interaction and Coevolution

Community Ecology

Ecosystems and Global Ecology

Conservation Biology

Filters

The precursors to the genes that cause the electric discharges in the electric organs of some fish evolved from _ genes that were involved in _.