Exam 24: Evolution of Genes and Genomes

Which of the following ranks the organisms correctly in terms of the proportion of coding DNA to noncoding DNA in their genomes (from smallest proportion to largest proportion)?

Paralogous genes are genes that trace back to a common

Which of the following scientists proposed the neutral theory of molecular evolution?

How is the study of molecular evolution important in efforts to combat HIV and other viral pathogens that have recently emerged?

In their studies of evolution within Pseudomonas, Rainsey and Travisano observed a new form called _______ that was able to form a mat across the medium's surface and thus compete more successfully for oxygen.

Use the following to answer questions: In a hypothetical experiment, researchers split a bacterial colony in two, allowing each of the new colonies to evolve separately. They then sequenced a gene from colony 1 and colony 2. -In the common ancestor, the nucleotide at site 327 is G. In colony 1, it changes to C; in colony 2, it also changes to C. This is an example of a _______ substitution.

Which of the following statements about ribosomal RNA (rRNA) genes is true?

Which of the following statements is true?

Use the following to answer questions : Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta. (a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG (b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG (c) AGGGTAGCTGTGCTCACCGCTCGTCGG -If we assume that a gap is equivalent to two nucleotide substitutions, how many substitutions have occurred between D. melanogaster and D. erecta?

Biased gene conversion is a mechanism of

Which of the following statements about the "living battery" electric organ possessed by some fish is true?

In which of the following animals would you find the enzyme lysozyme?

Which of the following is true of in vitro evolution?

According to the neutral theory of molecular evolution, the fastest rate of fixation of neutral mutations by genetic drift should occur in which of the following populations?

Which of the following can result from the misalignment of highly repeated genes?

In a eukaryote, one would expect to find the lowest rate of nonsynonymous nucleotide substitutions in an

Which of the following statements about synonymous substitutions is false?

Synonymous mutations of a gene

When researchers apply the principles of evolution to produce new molecules that can be used for pharmaceuticals, they are

In which of the following would you expect the greatest extent of lateral gene transfer?