Question 1

Kimura's _______ theory of molecular evolution proposes that most molecular variations in natural populations are selectively equivalent.

Accepted Answer

The answer of Kimura's _______ theory of molecular evolution proposes...

Question 2

Which of the following is true of the use of molecular evolutionary studies of human disease?

Accepted Answer

A)  Molecular evolutionary studies are useful for identifying many diseases. 
B)  Molecular evolutionary studies are often used to determine the origin of emerging diseases. 
C)  Molecular evolutionary studies are important for developing vaccines against diseases. 
D)  Molecular evolutionary studies are used to track the effectiveness of polio vaccines in human populations. 
E)  All of the above 
A)  Molecular evolutionary studies are useful for identifying many diseases. 
B)  Molecular evolutionary studies are often used to determine the origin of emerging diseases. 
C)  Molecular evolutionary studies are important for developing vaccines against diseases. 
D)  Molecular evolutionary studies are used to track the effectiveness of polio vaccines in human populations. 
E)  All of the above

Question 3

Which of the following statements is true?

Accepted Answer

A)  Transitions are more common than transversions. 
B)  A purine changing into another purine is a ­transversion. 
C)  A pyrimidine changing into a purine is a transition. 
D)  Both a and b 
E)  Both b and c 
A)  Transitions are more common than transversions. 
B)  A purine changing into another purine is a ­transversion. 
C)  A pyrimidine changing into a purine is a transition. 
D)  Both a and b 
E)  Both b and c

Question 4

The genome of a eukaryotic organism is best defined as

Accepted Answer

A)  all of the organism's protein-coding genes. 
B)  all of the organism's DNA contained in its nucleus. 
C)  all of the organism's genetic material. 
D)  a haploid set of all the organism's chromosomes. 
E)  all of the organism's DNA that is transcribed. 
A)  all of the organism's protein-coding genes. 
B)  all of the organism's DNA contained in its nucleus. 
C)  all of the organism's genetic material. 
D)  a haploid set of all the organism's chromosomes. 
E)  all of the organism's DNA that is transcribed.

Question 5

Investigations of the mechanisms and consequences of the evolution of macromolecules make up the field of _______.

Accepted Answer

The answer of Investigations of the mechanisms and consequences of...

Question 6

Which of the following were used by investigators to study the loss of genetic material in different insects?

Accepted Answer

A)  Retrotransposons 
B)  Coding genes 
C)  RNAs 
D)  Noncoding regions of the globin gene family 
E)  Bioprospecting genes 
A)  Retrotransposons 
B)  Coding genes 
C)  RNAs 
D)  Noncoding regions of the globin gene family 
E)  Bioprospecting genes

Question 7

Refer to Figure 24.12. Which of the following statements about this figure is false?

Accepted Answer

A)  Sea urchin En and lamprey En are paralogs. 
B)  All of the En (or Eng) genes are orthologs. 
C)  Zebrafish Eng2a and Eng2b arose by gene duplication. 
D)  The En2 and En1 gene groups are paralogous. 
E)  All of the En genes share a common ancestor. 
A)  Sea urchin En and lamprey En are paralogs. 
B)  All of the En (or Eng) genes are orthologs. 
C)  Zebrafish Eng2a and Eng2b arose by gene duplication. 
D)  The En2 and En1 gene groups are paralogous. 
E)  All of the En genes share a common ancestor.

Question 8

Studies of the structure of proteins such as cytochrome c and lysozyme in different species have shown that

Accepted Answer

A)  the rate of evolution of particular proteins is often relatively constant over time. 
B)  many nucleotide substitutions result either in no change in the amino acid sequence of the protein or in a change to a functionally equivalent amino acid. 
C)  there are fewer differences in the amino acid sequences of proteins whose organismal sources were closely related than in those whose sources were distantly related. 
D)  functionally important regions of a protein can be discovered by identifying the regions with the most amino acid substitutions. 
E)  All of the above 
A)  the rate of evolution of particular proteins is often relatively constant over time. 
B)  many nucleotide substitutions result either in no change in the amino acid sequence of the protein or in a change to a functionally equivalent amino acid. 
C)  there are fewer differences in the amino acid sequences of proteins whose organismal sources were closely related than in those whose sources were distantly related. 
D)  functionally important regions of a protein can be discovered by identifying the regions with the most amino acid substitutions. 
E)  All of the above

Question 9

Which of the following statements about the Rainey and Travisano experiments on Pseudomonas bacteria is true?

Accepted Answer

A)  The static cultures had a constantly uniform ­environment. 
B)  No phenotypic evolution occurred in the static cultures. 
C)  Molecular evidence showed that the same phenotype could arise from many genotypes. 
D)  Both a and b 
E)  None of the above 
A)  The static cultures had a constantly uniform ­environment. 
B)  No phenotypic evolution occurred in the static cultures. 
C)  Molecular evidence showed that the same phenotype could arise from many genotypes. 
D)  Both a and b 
E)  None of the above

Question 10

Experimental molecular evolutionary studies have shown that

Accepted Answer

A)  a heterogeneous environment favors adaptive radiation. 
B)  a heterogeneous environment induces an increase in the mutation rate. 
C)  even in bacteria, substantial molecular evolution cannot be observed in less than a year. 
D)  Both a and b 
E)  None of the above 
A)  a heterogeneous environment favors adaptive radiation. 
B)  a heterogeneous environment induces an increase in the mutation rate. 
C)  even in bacteria, substantial molecular evolution cannot be observed in less than a year. 
D)  Both a and b 
E)  None of the above

Question 11

Before nucleotide and amino acid sequences can be compared in an evolutionary framework, they must be aligned to account for

Accepted Answer

A)  deletions and insertions. 
B)  selection and neutrality. 
C)  parallelisms and convergences. 
D)  gene families. 
E)  All of the above 
A)  deletions and insertions. 
B)  selection and neutrality. 
C)  parallelisms and convergences. 
D)  gene families. 
E)  All of the above

Question 12

When a gene is duplicated, which of the following may occur?

Accepted Answer

A)  Production of the gene's product may increase. 
B)  The two copies may become expressed in different tissues. 
C)  One copy of the gene may accumulate deleterious substitutions and become functionless. 
D)  The two copies may diverge and acquire different functions. 
E)  All of the above 
A)  Production of the gene's product may increase. 
B)  The two copies may become expressed in different tissues. 
C)  One copy of the gene may accumulate deleterious substitutions and become functionless. 
D)  The two copies may diverge and acquire different functions. 
E)  All of the above

Question 13

The human genome contains _______ genes.

Accepted Answer

A)  less than 15,000 
B)  between 15,000 and 30,000 
C)  between 30,000 and 50,000 
D)  between 50,000 and 100,000 
E)  more than 100,000 
A)  less than 15,000 
B)  between 15,000 and 30,000 
C)  between 30,000 and 50,000 
D)  between 50,000 and 100,000 
E)  more than 100,000

Question 14

Nonsynonymous mutations in a gene coding for a protein

Accepted Answer

A)  result in the replacement of an amino acid in the protein. 
B)  may be neutral. 
C)  may be deleterious. 
D)  may be beneficial. 
E)  All of the above 
A)  result in the replacement of an amino acid in the protein. 
B)  may be neutral. 
C)  may be deleterious. 
D)  may be beneficial. 
E)  All of the above

Question 15

Gene duplication may involve

Accepted Answer

A)  part of a gene. 
B)  a whole gene. 
C)  whole chromosomes. 
D)  All of the above 
E)  None of the above 
A)  part of a gene. 
B)  a whole gene. 
C)  whole chromosomes. 
D)  All of the above 
E)  None of the above

Question 16

In the amino acid sequences shown in Figure 24.1, position(s) _______ are conserved and positions _______ shows the most variation in amino acid identity. The amino acids are labeled sequentially from left to right.

Accepted Answer

A)  1, 2, 4, and 7; 5 
B)  1, 4, and 7; 2 
C)  1 and 7; 5 
D)  1, 4, and 7; 5 
E)  1, 2, and 7; 5 
A)  1, 2, 4, and 7; 5 
B)  1, 4, and 7; 2 
C)  1 and 7; 5 
D)  1, 4, and 7; 5 
E)  1, 2, and 7; 5

Question 17

Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How would you align the three sequences so that they could be used for making comparisons?

Accepted Answer

To properly align the sequences, a gap s

Question 18

Which of the following statements about genome evolution is true?

Accepted Answer

A)  Humans have between 10 and 20 times more genes than does Drosophila. 
B)  Many species have more than 500 times the number of protein-coding genes than the typical bacteria have. 
C)  Some salamanders have about 40 times as much DNA as humans do. 
D)  A larger genome always indicates greater complexity. 
E)  None of the above 
A)  Humans have between 10 and 20 times more genes than does Drosophila. 
B)  Many species have more than 500 times the number of protein-coding genes than the typical bacteria have. 
C)  Some salamanders have about 40 times as much DNA as humans do. 
D)  A larger genome always indicates greater complexity. 
E)  None of the above

Question 19

The alignment of the amino acid sequences of a protein from different species

Accepted Answer

A)  may be complicated by the presence of insertions in some of the proteins. 
B)  always reveals the total number of substitutions that have occurred. 
C)  can be used as a molecular clock since all proteins evolve at the same rate. 
D)  can be used to calculate evolutionary divergence. 
E)  Both a and d 
A)  may be complicated by the presence of insertions in some of the proteins. 
B)  always reveals the total number of substitutions that have occurred. 
C)  can be used as a molecular clock since all proteins evolve at the same rate. 
D)  can be used to calculate evolutionary divergence. 
E)  Both a and d

Question 20

Which of the following statements about genomes is true?

Accepted Answer

A)  All plants have genome sizes that are smaller than those of all animals. 
B)  Humans have the largest genome size of all animals. 
C)  Most of the bacterial genome is noncoding. 
D)  All of the above 
E)  None of the above 
A)  All plants have genome sizes that are smaller than those of all animals. 
B)  Humans have the largest genome size of all animals. 
C)  Most of the bacterial genome is noncoding. 
D)  All of the above 
E)  None of the above

Exam 24: Evolution of Genes and Genomes

Kimura's _______ theory of molecular evolution proposes that most molecular variations in natural populations are selectively equivalent.

Which of the following is true of the use of molecular evolutionary studies of human disease?

Which of the following statements is true?

The genome of a eukaryotic organism is best defined as

Investigations of the mechanisms and consequences of the evolution of macromolecules make up the field of _______.

Which of the following were used by investigators to study the loss of genetic material in different insects?

Refer to Figure 24.12. Which of the following statements about this figure is false?

Studies of the structure of proteins such as cytochrome c and lysozyme in different species have shown that

Which of the following statements about the Rainey and Travisano experiments on Pseudomonas bacteria is true?

Experimental molecular evolutionary studies have shown that

Before nucleotide and amino acid sequences can be compared in an evolutionary framework, they must be aligned to account for

When a gene is duplicated, which of the following may occur?

The human genome contains _______ genes.

Nonsynonymous mutations in a gene coding for a protein

Gene duplication may involve

In the amino acid sequences shown in Figure 24.1, position(s) _______ are conserved and positions _______ shows the most variation in amino acid identity. The amino acids are labeled sequentially from left to right.

Which of the following statements about genome evolution is true?

The alignment of the amino acid sequences of a protein from different species

Which of the following statements about genomes is true?

Studying Life

Small Molecules and the Chemistry of Life

Proteins, Carbohydrates, and Lipids

Nucleic Acids and the Origin of Life

Cells: the Working Units of Life

Cell Membranes

Cell Signaling and Communication

Energy, Enzymes, and Metabolism

Pathways That Harvest Chemical Energy

Photosynthesis: Energy From Sunlight

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

Dna and Its Role in Heredity

From Dna to Protein: Gene Expression

Gene Mutation and Molecular Medicine

Regulation of Gene Expression

Genomes

Recombinent Dna and Biotechnology

Differential Gene Expression in Development

Development and Evolutionary Change

Evidence and Mechanisms of Evolution

Reconstructing and Using Phylogenies

Species and Their Formation

The History of Life on Earth

Bacteria and Archaea: the Prokaryotic Domains

The Origin and Diversification of Eukaryotes

Plants Without Seeds: From Water to Land

The Evolution of Seed Plants

Fungi: Recyclers, Pathogens, Parasites, and Plant Partners

Animal Origins and the Evolution of Body Plans

Protostome Animals

Deuterostome Animals

The Plant Body

Transport in Plants

Plant Nutrition

Regulation of Plant Growth

Reproduction in Flowering Plants

Plant Responses to Environmental Challenges

Physiology, Homeostasis, and Temperature Regulation

Animal Hormones

Immunology: Animal Defense Systems

Animal Reproduction

Animal Development

Neurons and Nervous Systems

Sensory Systems

The Mammalian Nervous System: Structure and Higher Function

Musculoskeletal Systems

Gas Exchange in Animals

Circulatory Systems

Nutrition, Digestion, and Absorption

Salt and Water Balance and Nitrogen

Animal Behavior

Ecology and the Distribution of Life

Population Ecology

Species Interaction and Coevolution

Community Ecology

Ecosystems and Global Ecology

Conservation Biology

Filters

In the amino acid sequences shown in Figure 24.1, position(s) _ are conserved and positions _ shows the most variation in amino acid identity. The amino acids are labeled sequentially from left to right.