Essay
Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-If we assume that a gap is equivalent to two nucleotide substitutions, how many substitutions have occurred between D. melanogaster and D. erecta?
Correct Answer:
Verified
Four. The gap counts as two, a...View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q4: How is the study of molecular evolution
Q5: In their studies of evolution within Pseudomonas,
Q6: Use the following to answer questions:<br>In a
Q7: Which of the following statements about ribosomal
Q8: Which of the following statements is true?<br>A)
Q10: Biased gene conversion is a mechanism of<br>A)
Q11: Which of the following statements about the
Q12: In which of the following animals would
Q13: Which of the following is true of
Q14: According to the neutral theory of molecular