Short Answer
Use the following to answer questions :
Suppose that sequences were obtained from a hypothetical gene in three species of Drosophila: (a) is the sequence from D. melanogaster, (b) is from D. simulans, and (c) is from D. erecta.
(a) AGGCTTGTAGCTGTGCTCGCCGCTAGTCGG
(b) AGGCTTGTAGCTGTGCTCGCCGCTAGTAGG
(c) AGGGTAGCTGTGCTCACCGCTCGTCGG
-How many substitutions have occurred between D. melanogaster and D. simulans?
Correct Answer:
Verified
One (the C...View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Correct Answer:
Verified
View Answer
Unlock this answer now
Get Access to more Verified Answers free of charge
Q44: Regions of a DNA sequence that are
Q45: The hands of humans and the wings
Q46: Which of the following statements is correct?<br>A)
Q47: Which of the following statements about gene
Q50: If one is interested in reconstructing the
Q51: Use the following to answer questions :<br>Sequences
Q52: Which of the following is not true
Q53: The developmental genes bicoid and zen are
Q54: Which of the following statements about the
Q249: Orthologous genes are genes that can be