Exam 17: Origins and Evolution

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like? (1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG (2) AAATGTTGGGATTCCGGAAGTAGTGAGTG (3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG (4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

The Long-Term Evolution Experiment (LTEE) has been conducted by Richard Lenski at Michigan State University since 1988. The purpose of the experiment is to observe evolution in action in a laboratory environment. Use the figure below to explain what physiological adaptations allowed one of the Escherichia coli strains to grow to a much higher density after 33,000 generations.

How can plants be so efficient photosynthetically if the chloroplast genome has fewer genes when compared with free-living cyanobacteria?

The disease filariasis is caused by the ________, which harbors Wolbachia endosymbionts.

Briefly discuss the types of geological evidence of early life and their advantages and limitations.

Evidence in the study of adaptive evolution CANNOT be obtained from

How do membrane compartments spontaneously arise from the properties of fatty acid glycerol esters?

Which of the following is NOT correct regarding conditions for life on Earth?

The term "________" indicates that the members of a clade share a common ancestor, one not shared by any group outside the clade.

In the study of rapid adaptive evolution through exposure to strongly selective environments, the energy cost to an organism that emerges as the fittest is that it is

Which label on the figure below is NOT correct?

What are stromatolites?

The presence of cells of the alga Chorella growing within Paramecium bursaria is an example of

Spikes in ________ content often indicate that a horizontal gene transfer has occurred in the genome.

The figure below shows two ways to represent phylogenetic relationships using rRNA from several thermophiles from Obsidian Pool in Yellowstone National Park. The principal advantage to unrooted trees, when compared to rooted trees, is that they

Evidence of life left in the geological record is known as

Which branch of taxonomy deals with the sorting of life-forms into bins (categories) based on genetic relatedness and traits of the organisms?

Studies on the genome of Bacillus species have revealed that Bacillus anthracis has a "closed" pan-genome, whereas Bacillus cereus has an open pan-genome. What does this mean, and why did these two species evolve in this manner?

Why do bacterial antibiotics have a greater effect on diminishing the effects of nematode infection caused by Brugia malayi (the etiologic agent of filariasis) than current antinematode agents?

Refer to the figure below and briefly discuss the possible origin of the genetic code.