Exam 17: Origins and Evolution

Studies on the genome of Bacillus species have revealed that Bacillus anthracis has a "closed" pan-genome, whereas Bacillus cereus has an open pan-genome. What does this mean, and why did these two species evolve in this manner?

Which of the following did early methanogens use from the early atmosphere to generate energy?

The presence of cells of the alga Chorella growing within Paramecium bursaria is an example of

All of the following are examples of "operational genes," EXCEPT ________ genes.

The term "________" indicates that the members of a clade share a common ancestor, one not shared by any group outside the clade.

Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like? (1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG (2) AAATGTTGGGATTCCGGAAGTAGTGAGTG (3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG (4) AAATGATGGGCTTCCGGGAGCGAGTGCCC

A clade could best be described as a

A molecular clock is best defined as

In the domains of life, archaea and eukarya differ from each other in that archaea ________ and eukarya ________.

The most likely ancestor for today's mitochondria according to the endosymbiotic model is a(n)