Question 1

When one base is changed to another at a single position in the DNA sequence of a gene,the result is a(n)________ mutation.

Accepted Answer

A)  insertion 
B)  deletion 
C)  frameshift 
D)  substitution 
A)  insertion 
B)  deletion 
C)  frameshift 
D)  substitution

Question 2

The lac repressor has been mutated so that its binding site for lactose has been altered to the extent that it is unable to bind to lactose.What is the likely effect of this mutation on the lac operon?

Accepted Answer

A)  The repressor will be unable to bind to the operator,and the operon will thus be turned on. 
B)  The repressor will bind to the operator and suppress transcription of the operon despite the presence of lactose. 
C)  The lac operon will be degraded by the altered repressor. 
D)  The repressor will bind to the operator and enhance the ability of RNA polymerase to bind there. 
A)  The repressor will be unable to bind to the operator,and the operon will thus be turned on. 
B)  The repressor will bind to the operator and suppress transcription of the operon despite the presence of lactose. 
C)  The lac operon will be degraded by the altered repressor. 
D)  The repressor will bind to the operator and enhance the ability of RNA polymerase to bind there.

Question 3

If a particular segment of DNA has the base sequence TAC,what will be the base sequence of the anticodon of the tRNA that carries the amino acid encoded by that stretch of DNA?

Accepted Answer

A)  TAC 
B)  UAC 
C)  ATG 
D)  GUC 
A)  TAC 
B)  UAC 
C)  ATG 
D)  GUC

Question 4

What is the sequence of the codon that the transfer RNA shown in the following figure would bind to during translation?

Accepted Answer

A)  AGC 
B)  UGC 
C)  TGC 
D)  serine 
A)  AGC 
B)  UGC 
C)  TGC 
D)  serine

Question 5

Ribosomal RNA plays a role in the formation of the covalent bonds between amino acids during translation.

Accepted Answer

A) True 
 B)False

Question 6

Which of the following does NOT take place in the nucleus?

Accepted Answer

A)  transcription 
B)  RNA splicing 
C)  replication 
D)  translation 
A)  transcription 
B)  RNA splicing 
C)  replication 
D)  translation

Question 7

For translation to begin,mRNA must first bind to a ________.

Accepted Answer

The answer of For translation to begin,mRNA must first bind...

Question 8

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

Accepted Answer

A)  tyrosine-tyrosine-alanine 
B)  tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine 
C)  methionine-proline-glutamate 
D)  methionine-proline-glutamate-isoleucine-alanine 
A)  tyrosine-tyrosine-alanine 
B)  tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine 
C)  methionine-proline-glutamate 
D)  methionine-proline-glutamate-isoleucine-alanine

Exam 12: From Gene to Protein

When one base is changed to another at a single position in the DNA sequence of a gene,the result is a(n)________ mutation.

The lac repressor has been mutated so that its binding site for lactose has been altered to the extent that it is unable to bind to lactose.What is the likely effect of this mutation on the lac operon?

If a particular segment of DNA has the base sequence TAC,what will be the base sequence of the anticodon of the tRNA that carries the amino acid encoded by that stretch of DNA?

What is the sequence of the codon that the transfer RNA shown in the following figure would bind to during translation?

Ribosomal RNA plays a role in the formation of the covalent bonds between amino acids during translation.

Which of the following does NOT take place in the nucleus?

For translation to begin,mRNA must first bind to a ________.

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

The Nature of Science and the Characteristics of Life

The Chemistry of Life

Cell Structure and Internal Compartments

Cell Membranes, Transport, and Communication

Energy, Metabolism, and Enzymes

Photosynthesis and Cellular Respiration

Cell Division

Cancer and Human Health

Patterns of Inheritance

Chromosomes and Human Genetics

DNA and Genes

DNA Technology

How Evolution Works

The Origin of Species

The Evolution of Biodiversity

Biological Diversity, Bacteria, and Archaea

Protista, Plantae, and Fungi

Animalia

The Biosphere

Growth of Populations

Animal Behavior

Ecological Communities

Ecosystems

Global Change

Internal Organization and Homeostasis

Nutrition and Digestion

Circulation and Gas Exchange

Animal Hormones

Nervous and Sensory Systems

Skeletons,Muscles,and Movement

The Immune System

Reproduction and Development

Plant Structure, Nutrition, and Transport

Plant Growth and Reproduction

Filters