Using the Following Chart,which Chain of Amino Acids Would Be

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine

Correct Answer:

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Access For Free