Question 1

The double helix of DNA in the B-form is stabilized by:

Accepted Answer

A)  covalent bonds between the 3' end of one strand and the 5' end of the other. 
B)  hydrogen bonding between the phosphate groups of two side-by-side strands. 
C)  hydrogen bonds between the riboses of each strand. 
D)  nonspecific base-stacking interaction between two adjacent bases in the same strand. 
E)  ribose interactions with the planar base pairs. 
A)  covalent bonds between the 3' end of one strand and the 5' end of the other. 
B)  hydrogen bonding between the phosphate groups of two side-by-side strands. 
C)  hydrogen bonds between the riboses of each strand. 
D)  nonspecific base-stacking interaction between two adjacent bases in the same strand. 
E)  ribose interactions with the planar base pairs. D

Question 2

In living cells, nucleotides and their derivatives can serve as:

Accepted Answer

A)  carriers of metabolic energy. 
B)  enzyme cofactors. 
C)  intracellular signals. 
D)  precursors for nucleic acid synthesis. 
E)  All of the answers are correct. 
A)  carriers of metabolic energy. 
B)  enzyme cofactors. 
C)  intracellular signals. 
D)  precursors for nucleic acid synthesis. 
E)  All of the answers are correct. E

Question 3

In the Watson-Crick model for the DNA double helix, which statement is NOT true?

Accepted Answer

A)  The two strands run anti-parallel to one another. 
B)  The base-pairing occurs on the inside of the double helix. 
C)  The double helix is right-handed. 
D)  There are two equally sized grooves that run up the sides of the helix. 
E)  The two strands have complementary sequences. 
A)  The two strands run anti-parallel to one another. 
B)  The base-pairing occurs on the inside of the double helix. 
C)  The double helix is right-handed. 
D)  There are two equally sized grooves that run up the sides of the helix. 
E)  The two strands have complementary sequences. D

Question 4

Which statement describes a function of the addition of methyl groups to DNA?

Accepted Answer

A)  Methylation is used by E. coli as part of a defense mechanism to distinguish its DNA from foreign DNA. 
B)  Methylation serves as a marker during repair of DNA during replication. 
C)  Methylation of DNA occurs in some animals when infected with certain bacteriophages. 
D)  All of the statements describe a function of DNA methylation. 
E)  None of the statements describes a function of DNA methylation. 
A)  Methylation is used by E. coli as part of a defense mechanism to distinguish its DNA from foreign DNA. 
B)  Methylation serves as a marker during repair of DNA during replication. 
C)  Methylation of DNA occurs in some animals when infected with certain bacteriophages. 
D)  All of the statements describe a function of DNA methylation. 
E)  None of the statements describes a function of DNA methylation.

Question 5

What is the MOST likely length of an mRNA that will code for a polypeptide with 150 amino acids?

Accepted Answer

A)  50 nucleotides 
B)  150 nucleotides 
C)  450 nucleotides 
D)  >450 nucleotides 
E)  All of these lengths are possible depending on the organism in which the mRNA is found. 
A)  50 nucleotides 
B)  150 nucleotides 
C)  450 nucleotides 
D)  >450 nucleotides 
E)  All of these lengths are possible depending on the organism in which the mRNA is found.

Question 6

Hoogsteen base-pairing occurs when a third strand of DNA binds along the _____ of a double helix of DNA.

Accepted Answer

A)  minor groove 
B)  major groove 
C)  free 5'end 
D)  free 3'end 
E)  Any of these parts of a DNA double helix could participate in a Hoogsteen interaction. 
A)  minor groove 
B)  major groove 
C)  free 5'end 
D)  free 3'end 
E)  Any of these parts of a DNA double helix could participate in a Hoogsteen interaction.

Question 7

The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with:

Accepted Answer

A)  (5')CACTAGTTCG(3'). 
B)  (5')CACUAGUUCG(3'). 
C)  (5')CACUTTCGCCC(3'). 
D)  (5')GCTTGATCAC(3'). 
E)  (5')GCCTAGTTUG(3'). 
A)  (5')CACTAGTTCG(3'). 
B)  (5')CACUAGUUCG(3'). 
C)  (5')CACUTTCGCCC(3'). 
D)  (5')GCTTGATCAC(3'). 
E)  (5')GCCTAGTTUG(3').

Question 8

Why does lowering the ionic strength of a solution of double-stranded DNA permit the DNA to denature more readily (for example, to denature at a lower temperature than at a higher ionic strength)?

Accepted Answer

Lowering the ionic strength of a solutio

Question 9

B-form DNA in vivo is a _____-handed helix, _____ Å in diameter, with a rise of _____ Å per base pair.

Accepted Answer

A)  left; 20; 3.9 
B)  right; 18; 3.4 
C)  right; 18; 3.6 
D)  right; 20; 3.4 
E)  right; 23; 2.6 
A)  left; 20; 3.9 
B)  right; 18; 3.4 
C)  right; 18; 3.6 
D)  right; 20; 3.4 
E)  right; 23; 2.6

Question 10

Which single-stranded nucleic acid could form a hairpin structure?

Accepted Answer

A)  5' TTTGCGATACTCATCGCATT 3' 
B)  5'TTTGCGATACTCACGCTATT 3' 
C)  5' TTTGCGATACTCTGCGATTT 3' 
D)  All of the answers are correct. 
E)  None of the answers is correct. 
A)  5' TTTGCGATACTCATCGCATT 3' 
B)  5'TTTGCGATACTCACGCTATT 3' 
C)  5' TTTGCGATACTCTGCGATTT 3' 
D)  All of the answers are correct. 
E)  None of the answers is correct.

Question 11

In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is/are:

Accepted Answer

A)  heat. 
B)  low pH. 
C)  oxygen. 
D)  UV light. 
E)  both oxygen and UV light. 
A)  heat. 
B)  low pH. 
C)  oxygen. 
D)  UV light. 
E)  both oxygen and UV light.

Question 12

The CORRECT name for the molecule shown below is:

Accepted Answer

A)  5-methylcytidine. 
B)  C5-methylcytidine. 
C)  5-methyluridine. 
D)  C5-methylthymidine. 
E)  5-methylthymidine. 
A)  5-methylcytidine. 
B)  C5-methylcytidine. 
C)  5-methyluridine. 
D)  C5-methylthymidine. 
E)  5-methylthymidine.

Question 13

Which statement is NOT true about base stacking when nucleic acids are in a double-stranded conformation?

Accepted Answer

A)  Stacking interactions occur when two or more bases are positioned with their rings parallel to each other. 
B)  Stacking interactions are hydrophilic in nature. 
C)  Stacking involves a combination of van der Waals and dipole-dipole interactions between bases. 
D)  Base stacking helps to minimize contact of the bases with water. 
E)  Base stacking interactions are important in stabilizing the three-dimensional structure of nucleic acids. 
A)  Stacking interactions occur when two or more bases are positioned with their rings parallel to each other. 
B)  Stacking interactions are hydrophilic in nature. 
C)  Stacking involves a combination of van der Waals and dipole-dipole interactions between bases. 
D)  Base stacking helps to minimize contact of the bases with water. 
E)  Base stacking interactions are important in stabilizing the three-dimensional structure of nucleic acids.

Question 14

For the helix in double-stranded B-form DNA, the majority of the stability can be attributed to:

Accepted Answer

A)  base-pairing interactions via H-bonds. 
B)  interactions along the phosphate backbone. 
C)  base-stacking interactions via van-der-Waals interactions. 
D)  covalent bonds between adjacent bases in one strand. 
E)  ionic interactions with metal ions. 
A)  base-pairing interactions via H-bonds. 
B)  interactions along the phosphate backbone. 
C)  base-stacking interactions via van-der-Waals interactions. 
D)  covalent bonds between adjacent bases in one strand. 
E)  ionic interactions with metal ions.

Question 15

Chargaff's rules state that in typical DNA:

Accepted Answer

A)  A = G. 
B)  A = C. 
C)  A = U. 
D)  A + T = G + C. 
E)  A + G = T + C. 
A)  A = G. 
B)  A = C. 
C)  A = U. 
D)  A + T = G + C. 
E)  A + G = T + C.

Question 16

Describe briefly how noncovalent interactions contribute to the three-dimensional shapes of RNA molecules.

Accepted Answer

Noncovalent interactions, such as hydrog

Question 17

The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that:

Accepted Answer

A)  bacteria can undergo transformation. 
B)  genes are composed of DNA only. 
C)  mice are more susceptible to pneumonia than are humans. 
D)  pneumonia can be cured by transformation. 
E)  virulence is determine genetically. 
A)  bacteria can undergo transformation. 
B)  genes are composed of DNA only. 
C)  mice are more susceptible to pneumonia than are humans. 
D)  pneumonia can be cured by transformation. 
E)  virulence is determine genetically.

Question 18

What is the approximate length of a DNA molecule (in the B form) containing 10,000 base pairs?

Accepted Answer

The B form of DNA, which is the most com

Question 19

The composition (mole fraction) of one of the strands of a double-helical DNA is [A] = 0.3, and [G] = 0.24. Calculate the following, if possible. If impossible, write "I."
For the same strand:
[T] = (a) ____
[C] = (b) ____
[T] + [C] = (c) ____
For the other strand:
[A] = (d) ____
[T] = (e) ____
[A] + [T] = (f) ____
[G] = (g) ____
[C] = (h) ____
[G] + [C] = (i) ____

Accepted Answer

In a double-helical DNA, the bases pair

Question 20

In a double-stranded nucleic acid, cytosine typically base-pairs with:

Accepted Answer

A)  adenosine. 
B)  guanine. 
C)  inosine. 
D)  thymine. 
E)  uracil. 
A)  adenosine. 
B)  guanine. 
C)  inosine. 
D)  thymine. 
E)  uracil.

Exam 8: Nucleotides and Nucleic Acids

The double helix of DNA in the B-form is stabilized by:

In living cells, nucleotides and their derivatives can serve as:

In the Watson-Crick model for the DNA double helix, which statement is NOT true?

Which statement describes a function of the addition of methyl groups to DNA?

What is the MOST likely length of an mRNA that will code for a polypeptide with 150 amino acids?

Hoogsteen base-pairing occurs when a third strand of DNA binds along the _____ of a double helix of DNA.

The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with:

Why does lowering the ionic strength of a solution of double-stranded DNA permit the DNA to denature more readily (for example, to denature at a lower temperature than at a higher ionic strength)?

B-form DNA in vivo is a _____-handed helix, _____ Å in diameter, with a rise of _____ Å per base pair.

Which single-stranded nucleic acid could form a hairpin structure?

In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is/are:

The CORRECT name for the molecule shown below is:

Which statement is NOT true about base stacking when nucleic acids are in a double-stranded conformation?

For the helix in double-stranded B-form DNA, the majority of the stability can be attributed to:

Chargaff's rules state that in typical DNA:

Describe briefly how noncovalent interactions contribute to the three-dimensional shapes of RNA molecules.

The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that:

What is the approximate length of a DNA molecule (in the B form) containing 10,000 base pairs?

In a double-stranded nucleic acid, cytosine typically base-pairs with:

The Foundations of Biochemistry

Water

Amino Acids, Peptides, and Proteins

The Three-Dimensional Structure of Proteins

Protein Function

Enzymes

Carbohydrates and Glycobiology

DNA-Based Information Technologies

Lipids

Biological Membranes and Transport

Biosignaling

Bioenergetics and Biochemical Reaction Types

Glycolysis, Gluconeogenesis, and the Pentose Phosphate Pathway

Principles of Metabolic Regulation

The Citric Acid Cycle

Fatty Acid Catabolism

Amino Acid Oxidation and the Production of Urea

Oxidative Phosphorylation and Photophosphorylation

Carbohydrate Biosynthesis in Plants and Bacteria

Lipid Biosynthesis

Biosynthesis of Amino Acids, Nucleotides, and Related Molecules

Hormonal Regulation and Integration of Mammalian Metabolism

Genes and Chromosomes

DNA Metabolism

RNA Metabolism

Protein Metabolism

Regulation of Gene Expression

Filters

B-form DNA in vivo is a ___-handed helix, _ Å in diameter, with a rise of ___ Å per base pair.