Question 1

List three types of DNA damage that require repair.

Accepted Answer

DNA is constantly subject to damage from

Question 2

What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli?

Accepted Answer

An Okazaki fragment is a short segment o

Question 3

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the $\beta$ subunit of bacterial DNA polymerase III in that it:

Accepted Answer

A)  facilitates replication of telomeres. 
B)  forms a circular sliding clamp to increase the processivity of replication. 
C)  has a 3ʹ$\rightarrow$ 5ʹ proofreading activity. 
D)  increases the speed but not the processivity of the replication complex. 
E)  participates in DNA repair. 
A)  facilitates replication of telomeres. 
B)  forms a circular sliding clamp to increase the processivity of replication. 
C)  has a 3ʹ$\rightarrow$ 5ʹ proofreading activity. 
D)  increases the speed but not the processivity of the replication complex. 
E)  participates in DNA repair.

Question 4

In E. coli replication, DNA gyrase does not require ATP hydrolysis to lower the linking number of its substrate. Why is this, and where does the energy come from?

Accepted Answer

The statement in the question is incorre

Question 5

What is NOT a process or characteristic associated with recA?

Accepted Answer

A)  It binds to ssDNA. 
B)  It forms part of DNA polymerase V. 
C)  It is involved in the homologous genetic recombination. 
D)  It facilitates strand invasion in repair pathways. 
E)  It forms a dimer with single-stranded DNA binding protein (SS
B)  and single-stranded DNA. 
A)  It binds to ssDNA. 
B)  It forms part of DNA polymerase V. 
C)  It is involved in the homologous genetic recombination. 
D)  It facilitates strand invasion in repair pathways. 
E)  It forms a dimer with single-stranded DNA binding protein (SS
B)  and single-stranded DNA.

Question 6

Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed). Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell. Explain.

Accepted Answer

Nucleotide polymerization is a thermodyn

Question 7

When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system:

Accepted Answer

A)  cannot distinguish the template strand from the newly replicated strand. 
B)  changes both the template strand and the newly replicated strand. 
C)  corrects the DNA strand that is methylated. 
D)  corrects the mismatch by changing the newly replicated strand. 
E)  corrects the mismatch by changing the template strand. 
A)  cannot distinguish the template strand from the newly replicated strand. 
B)  changes both the template strand and the newly replicated strand. 
C)  corrects the DNA strand that is methylated. 
D)  corrects the mismatch by changing the newly replicated strand. 
E)  corrects the mismatch by changing the template strand.

Question 8

The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis.
(5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3')
(3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

Accepted Answer

During DNA replication, the two strands

Question 9

Many bases in DNA are susceptible to spontaneous deamination. Which of the standard bases in DNA CANNOT spontaneously deaminate?

Accepted Answer

Among the standard bases in DNA, which i

Question 10

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:

Accepted Answer

A)  coenzyme A. 
B)  coenzyme Q. 
C)  FADH-. 
D)  pyridoxal phosphate (PLP). 
E)  thiamine pyrophosphate (TPP). 
A)  coenzyme A. 
B)  coenzyme Q. 
C)  FADH-. 
D)  pyridoxal phosphate (PLP). 
E)  thiamine pyrophosphate (TPP).

Question 11

Which enzyme is NOT directly involved in methyl-directed mismatch repair in E. coli?

Accepted Answer

A)  DNA glycosylase 
B)  DNA helicase II 
C)  DNA ligase 
D)  DNA polymerase III 
E)  exonuclease I 
A)  DNA glycosylase 
B)  DNA helicase II 
C)  DNA ligase 
D)  DNA polymerase III 
E)  exonuclease I

Question 12

Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.

Accepted Answer

During crossing over in meiosis, several

Question 13

Which process does NOT require the 5' to 3' exonuclease activity of Pol I in E. coli?

Accepted Answer

A)  joining of Okazaki fragments 
B)  nucleotide-excision repair 
C)  base-excision repair 
D)  nick translation 
E)  All of these require the 5' to 3' exonuclease activity of Pol I. 
A)  joining of Okazaki fragments 
B)  nucleotide-excision repair 
C)  base-excision repair 
D)  nick translation 
E)  All of these require the 5' to 3' exonuclease activity of Pol I.

Question 14

Which process or aspect is NOT associated with RecBCD?

Accepted Answer

A)  helicase activity 
B)  ATP hydrolysis 
C)  nuclease activity 
D)  sequence-specific binding interactions 
E)  generation of 5' overhangs 
A)  helicase activity 
B)  ATP hydrolysis 
C)  nuclease activity 
D)  sequence-specific binding interactions 
E)  generation of 5' overhangs

Question 15

The Ames test is used to:

Accepted Answer

A)  detect bacterial viruses. 
B)  determine the rate of DNA replication. 
C)  examine the potency of antibiotics. 
D)  measure the mutagenic effects of various chemical compounds. 
E)  quantify the damaging effects of UV light on DNA molecules. 
A)  detect bacterial viruses. 
B)  determine the rate of DNA replication. 
C)  examine the potency of antibiotics. 
D)  measure the mutagenic effects of various chemical compounds. 
E)  quantify the damaging effects of UV light on DNA molecules.

Question 16

Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.

Accepted Answer

Recombination plays a crucial role in th

Question 17

Briefly describe the biochemical role of the following enzymes in DNA replication in E. coli:
(a) DNA helicase; (b) primase; (c) the 3' $\rightarrow$ 5' exonuclease activity of DNA polymerase; (d) DNA 1igase; (e) topoisomerases; (f) the 5' $\rightarrow$ 3' exonuclease activity of DNA polymerase I.

Accepted Answer

(a) DNA helicase: DNA helicase is respon

Question 18

Which phrase does NOT describe an aspect of the nucleotide addition reaction catalyzed by E. coli DNA Pol III?

Accepted Answer

A)  activation of the 3' OH of the newly synthesized strand by a metal ion 
B)  a properly positioned phosphate 
C)  specific protein/base-pair interactions in the major groove 
D)  charge stabilization of all three phosphates on the substrate 
E)  All of these are important aspects of the addition reaction. 
A)  activation of the 3' OH of the newly synthesized strand by a metal ion 
B)  a properly positioned phosphate 
C)  specific protein/base-pair interactions in the major groove 
D)  charge stabilization of all three phosphates on the substrate 
E)  All of these are important aspects of the addition reaction.

Question 19

Which statement is FALSE?

Accepted Answer

A)  In vitro, the strand-exchange reaction can include formation of a Holliday intermediate. 
B)  In vitro, the strand-exchange reaction is accompanied by ATP hydrolysis. 
C)  In vitro, the strand-exchange reaction may involve transient formation of a three- or four-stranded DNA complex. 
D)  In vitro, the strand-exchange reaction needs RecA protein. 
E)  In vitro, the strand-exchange reaction requires DNA polymerase. 
A)  In vitro, the strand-exchange reaction can include formation of a Holliday intermediate. 
B)  In vitro, the strand-exchange reaction is accompanied by ATP hydrolysis. 
C)  In vitro, the strand-exchange reaction may involve transient formation of a three- or four-stranded DNA complex. 
D)  In vitro, the strand-exchange reaction needs RecA protein. 
E)  In vitro, the strand-exchange reaction requires DNA polymerase.

Question 20

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

Accepted Answer

The four key features of the current mod

Exam 25: DNA Metabolism

List three types of DNA damage that require repair.

What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli?

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the β\betaβ subunit of bacterial DNA polymerase III in that it:

In E. coli replication, DNA gyrase does not require ATP hydrolysis to lower the linking number of its substrate. Why is this, and where does the energy come from?

What is NOT a process or characteristic associated with recA?

Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed). Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell. Explain.

When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system:

The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis. (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

Many bases in DNA are susceptible to spontaneous deamination. Which of the standard bases in DNA CANNOT spontaneously deaminate?

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:

Which enzyme is NOT directly involved in methyl-directed mismatch repair in E. coli?

Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.

Which process does NOT require the 5' to 3' exonuclease activity of Pol I in E. coli?

Which process or aspect is NOT associated with RecBCD?

The Ames test is used to:

Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.

Which phrase does NOT describe an aspect of the nucleotide addition reaction catalyzed by E. coli DNA Pol III?

Which statement is FALSE?

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

The Foundations of Biochemistry

Water

Amino Acids, Peptides, and Proteins

The Three-Dimensional Structure of Proteins

Protein Function

Enzymes

Carbohydrates and Glycobiology

Nucleotides and Nucleic Acids

DNA-Based Information Technologies

Lipids

Biological Membranes and Transport

Biosignaling

Bioenergetics and Biochemical Reaction Types

Glycolysis, Gluconeogenesis, and the Pentose Phosphate Pathway

Principles of Metabolic Regulation

The Citric Acid Cycle

Fatty Acid Catabolism

Amino Acid Oxidation and the Production of Urea

Oxidative Phosphorylation and Photophosphorylation

Carbohydrate Biosynthesis in Plants and Bacteria

Lipid Biosynthesis

Biosynthesis of Amino Acids, Nucleotides, and Related Molecules

Hormonal Regulation and Integration of Mammalian Metabolism

Genes and Chromosomes

RNA Metabolism

Protein Metabolism

Regulation of Gene Expression

Filters

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the $\beta$ subunit of bacterial DNA polymerase III in that it: