Question 1

In the X-SCID gene therapy trial in which some of the patients developed leukemia,the "good copy" of the gene probably inserted near a(n)________ gene.

Accepted Answer

A)  short tandem repeat 
B)  immune system 
C)  housekeeping 
D)  tumor promoter 
A)  short tandem repeat 
B)  immune system 
C)  housekeeping 
D)  tumor promoter

Question 2

Genetically modified organisms may contain proteins,DNA,and ________ from another organism.

Accepted Answer

The answer of Genetically modified organisms may contain proteins,DNA,and ________...

Question 3

Why are housekeeping genes not used to create DNA fingerprints?

Accepted Answer

A)  They mutate often because they are unnecessary genes and so are highly variable. 
B)  They are important genes for every cell in every person and so are highly conserved. 
C)  They are found only in a few cell types,not all cell types. 
D)  They are expressed at a low rate in cells. 
A)  They mutate often because they are unnecessary genes and so are highly variable. 
B)  They are important genes for every cell in every person and so are highly conserved. 
C)  They are found only in a few cell types,not all cell types. 
D)  They are expressed at a low rate in cells.

Question 4

A detective finds a miniscule spot of blood on a murder suspect's shirt.What method would she expect the police lab to use to get enough DNA from the blood droplet to perform DNA fingerprinting?

Accepted Answer

A)  inserting the blood's DNA into viral DNA 
B)  polymerase chain reaction (PCR) 
C)  inserting the sample's DNA into a plasmid 
D)  using ligases to bond the DNA fragments together for sequencing 
A)  inserting the blood's DNA into viral DNA 
B)  polymerase chain reaction (PCR) 
C)  inserting the sample's DNA into a plasmid 
D)  using ligases to bond the DNA fragments together for sequencing

Question 5

DNA ________ occurs when complementary single-stranded DNA molecules from two different sources undergo base pairing.

Accepted Answer

The answer of DNA ________ occurs when complementary single-stranded DNA...

Question 6

Genetically modified organisms are also called________ organisms.

Accepted Answer

The answer of Genetically modified organisms are also called________ organisms....

Question 7

You are shown the following result of gel electrophoresis.Column 1 represents blood found on the arm of a crime victim,but it is not the victim's blood.The other columns are blood taken from various suspects.Which suspect's blood was found on the victim's arm?

Accepted Answer

A)  2 
B)  3 
C)  4 
D)  5 
A)  2 
B)  3 
C)  4 
D)  5

Question 8

To produce a recombinant subunit vaccine,genes from an infectious microbe are genetically engineered into bacteria or yeast.The protein products of the transgenic infectious microbe genes are

Accepted Answer

A)  antigens. 
B)  plasmids. 
C)  vectors. 
D)  restriction enzymes. 
A)  antigens. 
B)  plasmids. 
C)  vectors. 
D)  restriction enzymes.

Question 9

Skin graft tissue grown from the skin stem cells of a burn victim is an example of

Accepted Answer

A)  regenerative medicine. 
B)  reproductive cloning. 
C)  genetic engineering. 
D)  DNA fingerprinting. 
A)  regenerative medicine. 
B)  reproductive cloning. 
C)  genetic engineering. 
D)  DNA fingerprinting.

Question 10

In order to study a gene,a scientist needs to make many copies of that gene using

Accepted Answer

A)  gene therapy. 
B)  DNA microarrays. 
C)  restriction enzymes. 
D)  the polymerase chain reaction. 
A)  gene therapy. 
B)  DNA microarrays. 
C)  restriction enzymes. 
D)  the polymerase chain reaction.

Question 11

A segment of DNA in a test tube replicates and produces many copies of itself.What was probably in the test tube that enhanced this process?

Accepted Answer

A)  a ligase 
B)  a restriction enzyme 
C)  DNA polymerase 
D)  an electric current 
A)  a ligase 
B)  a restriction enzyme 
C)  DNA polymerase 
D)  an electric current

Question 12

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI?
AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

Accepted Answer

A)  One;SmaI does not cut this piece of DNA. 
B)  Two;SmaI cuts this piece of DNA once. 
C)  Two;SmaI cuts this piece of DNA twice. 
D)  Four;SmaI cuts this piece of DNA four times. 
A)  One;SmaI does not cut this piece of DNA. 
B)  Two;SmaI cuts this piece of DNA once. 
C)  Two;SmaI cuts this piece of DNA twice. 
D)  Four;SmaI cuts this piece of DNA four times.

Question 13

In the first step of the polymerase chain reaction (PCR),the two strands of the DNA being amplified must be separated by exposing the DNA to high ________.

Accepted Answer

heat,tempe

Question 14

An enzyme that catalyzes the formation of covalent bonds between two DNA fragments,creating a single piece of DNA,is a(n)________.

Accepted Answer

The answer of An enzyme that catalyzes the formation of...

Question 15

Cloned animals are genetically identical to the

Accepted Answer

A)  somatic cell donor 
B)  enucleated egg donor 
C)  surrogate mother 
D)  surrogate mother's mate 
A)  somatic cell donor 
B)  enucleated egg donor 
C)  surrogate mother 
D)  surrogate mother's mate

Question 16

Potatoes have been engineered to produce proteins from the bacteria that causes cholera,a diarrheal disease.This is an example of genetic engineering to

Accepted Answer

A)  enhance economically important species. 
B)  produce pharmaceutical products. 
C)  produce vaccines. 
D)  produce dangerous organisms. 
A)  enhance economically important species. 
B)  produce pharmaceutical products. 
C)  produce vaccines. 
D)  produce dangerous organisms.

Question 17

Tissue containing totipotent embryonic stem cells is difficult to obtain;what is the usual source?

Accepted Answer

A)  donated blastocysts produced by in vitro fertilization for women seeking fertility treatment 
B)  tissues from spontaneous miscarriage during the first trimester of pregnancy 
C)  blood and tissues extracted from the placenta after the birth of the fetus 
D)  cloned embryos produced by fusing a somatic cell with an enucleated egg cell 
A)  donated blastocysts produced by in vitro fertilization for women seeking fertility treatment 
B)  tissues from spontaneous miscarriage during the first trimester of pregnancy 
C)  blood and tissues extracted from the placenta after the birth of the fetus 
D)  cloned embryos produced by fusing a somatic cell with an enucleated egg cell

Question 18

The polymerase chain reaction (PCR)is used to

Accepted Answer

A)  produce many copies of a selected DNA sequence. 
B)  insert DNA from one organism into a new host. 
C)  screen for a particular gene. 
D)  deliver DNA products into a human patient. 
A)  produce many copies of a selected DNA sequence. 
B)  insert DNA from one organism into a new host. 
C)  screen for a particular gene. 
D)  deliver DNA products into a human patient.

Question 19

The FBI produces DNA fingerprints from 13 STRs using ________ based amplification.

Accepted Answer

The answer of The FBI produces DNA fingerprints from 13...

Question 20

The bacterium shown in the following image is a genetically modified organism.

Accepted Answer

A) True 
 B)False

Exam 13: DNA Technology

In the X-SCID gene therapy trial in which some of the patients developed leukemia,the "good copy" of the gene probably inserted near a(n)________ gene.

Genetically modified organisms may contain proteins,DNA,and ________ from another organism.

Why are housekeeping genes not used to create DNA fingerprints?

A detective finds a miniscule spot of blood on a murder suspect's shirt.What method would she expect the police lab to use to get enough DNA from the blood droplet to perform DNA fingerprinting?

DNA ________ occurs when complementary single-stranded DNA molecules from two different sources undergo base pairing.

Genetically modified organisms are also called________ organisms.

You are shown the following result of gel electrophoresis.Column 1 represents blood found on the arm of a crime victim,but it is not the victim's blood.The other columns are blood taken from various suspects.Which suspect's blood was found on the victim's arm?

To produce a recombinant subunit vaccine,genes from an infectious microbe are genetically engineered into bacteria or yeast.The protein products of the transgenic infectious microbe genes are

Skin graft tissue grown from the skin stem cells of a burn victim is an example of

In order to study a gene,a scientist needs to make many copies of that gene using

A segment of DNA in a test tube replicates and produces many copies of itself.What was probably in the test tube that enhanced this process?

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

In the first step of the polymerase chain reaction (PCR),the two strands of the DNA being amplified must be separated by exposing the DNA to high ________.

An enzyme that catalyzes the formation of covalent bonds between two DNA fragments,creating a single piece of DNA,is a(n)________.

Cloned animals are genetically identical to the

Potatoes have been engineered to produce proteins from the bacteria that causes cholera,a diarrheal disease.This is an example of genetic engineering to

Tissue containing totipotent embryonic stem cells is difficult to obtain;what is the usual source?

The polymerase chain reaction (PCR)is used to

The FBI produces DNA fingerprints from 13 STRs using ________ based amplification.

The bacterium shown in the following image is a genetically modified organism.

The Nature of Science and the Characteristics of Life

The Chemistry of Life

Cell Structure and Internal Compartments

Cell Membranes, Transport, and Communication

Energy, Metabolism, and Enzymes

Photosynthesis and Cellular Respiration

Cell Division

Cancer and Human Health

Patterns of Inheritance

Chromosomes and Human Genetics

DNA and Genes

From Gene to Protein

How Evolution Works

The Origin of Species

The Evolution of Biodiversity

Biological Diversity, Bacteria, and Archaea

Protista, Plantae, and Fungi

Animalia

The Biosphere

Growth of Populations

Animal Behavior

Ecological Communities

Ecosystems

Global Change

Internal Organization and Homeostasis

Nutrition and Digestion

Circulation and Gas Exchange

Animal Hormones

Nervous and Sensory Systems

Skeletons,Muscles,and Movement

The Immune System

Reproduction and Development

Plant Structure, Nutrition, and Transport

Plant Growth and Reproduction

Filters