Question 1

When plasmids are used to produce a desired protein,the ________.

Accepted Answer

A)  plasmids multiply and produce the protein outside of the bacterium 
B)  bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate 
C)  desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium 
D)  bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene 
A)  plasmids multiply and produce the protein outside of the bacterium 
B)  bacterial chromosome is genetically engineered, and the plasmid is used to help the bacterium replicate 
C)  desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium 
D)  bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene

Question 2

Transgenic animals are currently used ________.

Accepted Answer

A)  to produce potentially useful proteins 
B)  as food 
C)  as vectors for use in cloning human DNA 
D)  all of the answer options are correct 
A)  to produce potentially useful proteins 
B)  as food 
C)  as vectors for use in cloning human DNA 
D)  all of the answer options are correct

Question 3

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

Accepted Answer

A)  gene cloning 
B)  PCR 
C)  STR analysis 
D)  whole-genome shotgun method 
A)  gene cloning 
B)  PCR 
C)  STR analysis 
D)  whole-genome shotgun method

Question 4

Which of the following can act as a vector to introduce new genes into a cell?

Accepted Answer

A)  primers 
B)  ligase 
C)  restriction enzymes 
D)  plasmids 
A)  primers 
B)  ligase 
C)  restriction enzymes 
D)  plasmids

Question 5

To find the nucleotide sequence of human chromosomes,chromosomes had to be digested into small fragments and then ________.

Accepted Answer

A)  centrifuged and electrophoresed 
B)  fingerprinted 
C)  cloned and sequenced 
D)  restricted 
A)  centrifuged and electrophoresed 
B)  fingerprinted 
C)  cloned and sequenced 
D)  restricted

Question 6

FGA is one of the STRs that are used to compare DNA between different people.Why is FGA useful for comparing DNA between different people?

Accepted Answer

A)  FGA varies in the number of repeats between different people. 
B)  FGA varies in sequence between different people. 
C)  FGA is only present in some peoples' genomes. 
D)  FGA is present in different places in different peoples' genomes. 
A)  FGA varies in the number of repeats between different people. 
B)  FGA varies in sequence between different people. 
C)  FGA is only present in some peoples' genomes. 
D)  FGA is present in different places in different peoples' genomes.

Question 7

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

Accepted Answer

A)  0 times 
B)  1 time 
C)  2 times 
D)  3 times 
A)  0 times 
B)  1 time 
C)  2 times 
D)  3 times

Question 8

-The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to D.) Which DNA molecule is the largest?

Accepted Answer

A)  DNA molecule A 
B)  DNA molecule B 
C)  DNA molecule C 
D)  DNA molecule D 
A)  DNA molecule A 
B)  DNA molecule B 
C)  DNA molecule C 
D)  DNA molecule D

Question 9

"Sticky ends" are ________.

Accepted Answer

A)  single-stranded ends of fragments of double-stranded DNA 
B)  regions of double-stranded DNA that can be cut by a restriction enzyme 
C)  portions of DNA used as markers for STR analysis 
D)  regions of DNA amplified in PCR 
A)  single-stranded ends of fragments of double-stranded DNA 
B)  regions of double-stranded DNA that can be cut by a restriction enzyme 
C)  portions of DNA used as markers for STR analysis 
D)  regions of DNA amplified in PCR

Question 10

Scenario Questions
Please read the following scenario and then answer the following questions.
Molecular biologists have perfected DNA fingerprinting so that it is possible to use the technique to provide evidence to solve crimes and even identify a child's parents. Recently, a U.S. immigrant asked the U.S. Citizenship and Immigration Services for permission to have her young daughter who was living with grandparents in their homeland join her in the United States. Her request was denied because there was an apparent mix-up with the child's birth certificate and it could not be used as proof of maternity. Other forms of proof are required in cases such as this. The mother requested DNA fingerprinting to show that she was the mother of the daughter. Samples of DNA were taken from the mother (Mom) and the daughter (D) as well as from her son (S) living in the United States with her. STR analysis was run on the three samples, and the results are shown below.
  
-The results indicate that ________.

Accepted Answer

A)  she is not the mother of the son 
B)  she is the mother of daughter D 
C)  she is not the mother of daughter D 
D)  the mother could not be the mother of both the daughter and the son 
A)  she is not the mother of the son 
B)  she is the mother of daughter D 
C)  she is not the mother of daughter D 
D)  the mother could not be the mother of both the daughter and the son

When plasmids are used to produce a desired protein,the ________.

Transgenic animals are currently used ________.

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

Which of the following can act as a vector to introduce new genes into a cell?

To find the nucleotide sequence of human chromosomes,chromosomes had to be digested into small fragments and then ________.

FGA is one of the STRs that are used to compare DNA between different people.Why is FGA useful for comparing DNA between different people?

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

-The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to D.) Which DNA molecule is the largest?

"Sticky ends" are ________.

Introduction: Biology Today

Essential Chemistry for Biology

The Molecules of Life

A Tour of the Cell

The Working Cell

Cellular Respiration: Obtaining Energy from Food

Photosynthesis: Using Light to Make Food

Cellular Reproduction: Cells from Cells

Patterns of Inheritance

The Structure and Function of DNA

How Genes Are Controlled

How Populations Evolve

How Biological Diversity Evolves

The Evolution of Microbial Life

The Evolution of Plants and Fungi

The Evolution of Animals

An Introduction to Ecology and the Biosphere

Population Ecology

Communities and Ecosystems

Unifying Concepts of Animal Structure and Function

Nutrition and Digestion

Circulation and Respiration

The Body's Defenses

Hormones

Reproduction and Development

Nervous, Sensory, and Locomotor Systems

The Life of a Flowering Plant

The Working Plant

Filters

Exam 12: DNA Technology

When plasmids are used to produce a desired protein,the ________.

Transgenic animals are currently used ________.

The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of ________.

Which of the following can act as a vector to introduce new genes into a cell?

To find the nucleotide sequence of human chromosomes,chromosomes had to be digested into small fragments and then ________.

FGA is one of the STRs that are used to compare DNA between different people.Why is FGA useful for comparing DNA between different people?

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

-The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to D.) Which DNA molecule is the largest?

"Sticky ends" are ________.

Introduction: Biology Today

Essential Chemistry for Biology

The Molecules of Life

A Tour of the Cell

The Working Cell

Cellular Respiration: Obtaining Energy from Food

Photosynthesis: Using Light to Make Food

Cellular Reproduction: Cells from Cells

Patterns of Inheritance

The Structure and Function of DNA

How Genes Are Controlled

How Populations Evolve

How Biological Diversity Evolves

The Evolution of Microbial Life

The Evolution of Plants and Fungi

The Evolution of Animals

An Introduction to Ecology and the Biosphere

Population Ecology

Communities and Ecosystems

Unifying Concepts of Animal Structure and Function

Nutrition and Digestion

Circulation and Respiration

The Body's Defenses

Hormones

Reproduction and Development

Nervous, Sensory, and Locomotor Systems

The Life of a Flowering Plant

The Working Plant

Filters