Question 1

Which of the following correctly describes the sequence of events in formation of the ribosome assembly and associated RNAs and proteins?

Accepted Answer

A) small ribosome subunit associates with large subunit;mRNA associates next;IF with bound NTP brings in first f-Met-tRNA;IF then hydrolyses bound NTP. 
B) IF with bound NTP binds f-Met-tRNA;small ribosome subunit associates next;mRNA associates next;then large subunit;IF then hydrolyses bound NTP. 
C) small subunit associates with mRNA;IF w/ bound NTP brings in first f-Met-tRNA;IF then hydrolyses bound NTP;large subunit associates 
D) large subunit associates with mRNA;IF w/ bound NTP brings in first f-Met-tRNA;small subunit associates;IF then hydrolyses bound NTP. 
E) none of the above 
A) small ribosome subunit associates with large subunit;mRNA associates next;IF with bound NTP brings in first f-Met-tRNA;IF then hydrolyses bound NTP. 
B) IF with bound NTP binds f-Met-tRNA;small ribosome subunit associates next;mRNA associates next;then large subunit;IF then hydrolyses bound NTP. 
C) small subunit associates with mRNA;IF w/ bound NTP brings in first f-Met-tRNA;IF then hydrolyses bound NTP;large subunit associates 
D) large subunit associates with mRNA;IF w/ bound NTP brings in first f-Met-tRNA;small subunit associates;IF then hydrolyses bound NTP. 
E) none of the above

Question 2

The structural similarities of EF-G and the EF-Tu·tRNA complex indicate

Accepted Answer

A) EF-G may be used as a substitute for EF-Tu. 
B) EF-G may play a role in displacing the tRNA growing peptide. 
C) EF-G may mediate a change in conformation that facilitates EF-Tu binding. 
D) EF-G may be involved in facilitating binding of initiation factors. 
E) EF-G and EF-Tu are both required for proper initiation. 
A) EF-G may be used as a substitute for EF-Tu. 
B) EF-G may play a role in displacing the tRNA growing peptide. 
C) EF-G may mediate a change in conformation that facilitates EF-Tu binding. 
D) EF-G may be involved in facilitating binding of initiation factors. 
E) EF-G and EF-Tu are both required for proper initiation.

Question 3

A mutation in the DNA sequence prior to (on the 5ꞌside of)the ATG start site will result in which of the following?
(I)decreased binding efficiency of the TATA binding protein
(II)decreased promoter efficiency
(III)frameshift mutation

Accepted Answer

A) I 
B) II 
C) III 
D) I,II 
E) I,II,III 
A) I 
B) II 
C) III 
D) I,II 
E) I,II,III

Question 4

A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation.If the original sequence is as follows,which example below represents a silent mutation?
GUACAAGCAUGAAGUUUGGUAAGCG

Accepted Answer

A) GUGCAAGCAUGAAGUUUGGUAAGCG 
B) GUACAAGCAUGAAAUUUGGUAAGCG 
C) GUACAAGCAUGAAGUUGGGUAAGCG 
D) GUACAGGCAUGAAGUUUGGUAAGCG 
E) GUACAAGCAUGAAGUUUGGUAACCG 
A) GUGCAAGCAUGAAGUUUGGUAAGCG 
B) GUACAAGCAUGAAAUUUGGUAAGCG 
C) GUACAAGCAUGAAGUUGGGUAAGCG 
D) GUACAGGCAUGAAGUUUGGUAAGCG 
E) GUACAAGCAUGAAGUUUGGUAACCG

Question 5

Inhibitors of translation may be effective as

Accepted Answer

A) antibiotics. 
B) anticancer agents. 
C) research on translation. 
D) all of the above 
E) none of the above 
A) antibiotics. 
B) anticancer agents. 
C) research on translation. 
D) all of the above 
E) none of the above

Question 6

The steps required for peptide elongation at the ribosome are,respectively,

Accepted Answer

A) initiation,elongation and termination. 
B) decoding,transpeptidation,and translocation. 
C) initiation,elongation,and release. 
D) aa-tRNA binding,GTP-peptidation,and translocation. 
E) none of the above 
A) initiation,elongation and termination. 
B) decoding,transpeptidation,and translocation. 
C) initiation,elongation,and release. 
D) aa-tRNA binding,GTP-peptidation,and translocation. 
E) none of the above

Question 7

Which of the following best describes the wobble hypothesis?
(I)The degree of variance in base pairing is greater at the 5' end of the anticodon,thus accounting for more than one codon.
(II)The degree of variance in base pairing is greater at the 3' end of the anticodon,thus accounting for more than one codon
(III)Non-Watson-Crick base pairing is sometimes allowed in the last position of the anticodon-codon pairing.

Accepted Answer

A) I only 
B) II only 
C) I and III 
D) II and III 
E) III only 
A) I only 
B) II only 
C) I and III 
D) II and III 
E) III only

Question 8

Which of following best describes the process for attachment of amino acid to the appropriate tRNAs? (Note: AA = amino acid,Pi = phosphate,PPi = pyrophosphate)

Accepted Answer

A) AA + ATP → AA-P + ADP then AA-P + tRNA → AA-tRNA + Pi 
B) AA + ATP → AA-AMP + PPi thenAA-AMP + tRNA → AA-tRNA + AMP 
C) tRNA + ATP → tRNA-P + ADP then tRNA-P + AA → AA-tRNA + Pi 
D) tRNA + ATP → tRNA-AMP + PPi then tRNA-AMP + AA → AA-tRNA + AMP 
E) AA + GTP → AA-GMP + PPi then AA-GMP + tRNA → AA-tRNA + GMP 
A) AA + ATP → AA-P + ADP then AA-P + tRNA → AA-tRNA + Pi 
B) AA + ATP → AA-AMP + PPi thenAA-AMP + tRNA → AA-tRNA + AMP 
C) tRNA + ATP → tRNA-P + ADP then tRNA-P + AA → AA-tRNA + Pi 
D) tRNA + ATP → tRNA-AMP + PPi then tRNA-AMP + AA → AA-tRNA + AMP 
E) AA + GTP → AA-GMP + PPi then AA-GMP + tRNA → AA-tRNA + GMP

Question 9

Insertions or deletions of one or two nucleotides can cause

Accepted Answer

A) frameshift mutations. 
B) degenerate mutations. 
C) synonymous mutations. 
D) wobble codons. 
E) transpeptidation. 
A) frameshift mutations. 
B) degenerate mutations. 
C) synonymous mutations. 
D) wobble codons. 
E) transpeptidation.

Which of the following correctly describes the sequence of events in formation of the ribosome assembly and associated RNAs and proteins?

The structural similarities of EF-G and the EF-Tu·tRNA complex indicate

A mutation in the DNA sequence prior to (on the 5ꞌside of)the ATG start site will result in which of the following? (I)decreased binding efficiency of the TATA binding protein (II)decreased promoter efficiency (III)frameshift mutation

A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation.If the original sequence is as follows,which example below represents a silent mutation? GUACAAGCAUGAAGUUUGGUAAGCG

Inhibitors of translation may be effective as

The steps required for peptide elongation at the ribosome are,respectively,

Which of following best describes the process for attachment of amino acid to the appropriate tRNAs? (Note: AA = amino acid,P_i = phosphate,PP_i = pyrophosphate)

Insertions or deletions of one or two nucleotides can cause

Introduction to the Chemistry of Life

Water

Nucleotides, nucleic Acids, and Genetic Information

Amino Acids

Proteins: Primary Structure

Proteins: Three-Dimensional Structure

Protein Function Part I: Myoglobin and Hemoglobin

Carbohydrates

Lipids and Biological Membranes

Membrane Transport

Enzyme Catalysis

Enzyme Kinetics, inhibition and Control

Biochemical Signaling

Introduction to Metabolism

Glucose Catabolism

Glycogen Metabolism and Gluconeogenesis

Citric Acid Cycle

Electron Transport and Oxidative Phosphorylation

Photosynthesis

Lipid Metabolism

Amino Acid Metabolism

Mammalian Fuel Metabolism: Integration and Regulation

Nucleotide Metabolism

Nucleic Acid Structure

DNA Replication, repair and Recombination

Transcription and Rna Processing

Regulation of Gene Expression

Filters

Exam 27: Protein Synthesis

Which of the following correctly describes the sequence of events in formation of the ribosome assembly and associated RNAs and proteins?

The structural similarities of EF-G and the EF-Tu·tRNA complex indicate

A mutation in the DNA sequence prior to (on the 5ꞌside of)the ATG start site will result in which of the following? (I)decreased binding efficiency of the TATA binding protein (II)decreased promoter efficiency (III)frameshift mutation

A silent mutation occurs when a nucleotide mutation results in the identical amino acid in place upon completion of translation.If the original sequence is as follows,which example below represents a silent mutation? GUACAAGCAUGAAGUUUGGUAAGCG

Inhibitors of translation may be effective as

The steps required for peptide elongation at the ribosome are,respectively,

Which of following best describes the process for attachment of amino acid to the appropriate tRNAs? (Note: AA = amino acid,Pi = phosphate,PPi = pyrophosphate)

Insertions or deletions of one or two nucleotides can cause

Introduction to the Chemistry of Life

Water

Nucleotides, nucleic Acids, and Genetic Information

Amino Acids

Proteins: Primary Structure

Proteins: Three-Dimensional Structure

Protein Function Part I: Myoglobin and Hemoglobin

Carbohydrates

Lipids and Biological Membranes

Membrane Transport

Enzyme Catalysis

Enzyme Kinetics, inhibition and Control

Biochemical Signaling

Introduction to Metabolism

Glucose Catabolism

Glycogen Metabolism and Gluconeogenesis

Citric Acid Cycle

Electron Transport and Oxidative Phosphorylation

Photosynthesis

Lipid Metabolism

Amino Acid Metabolism

Mammalian Fuel Metabolism: Integration and Regulation

Nucleotide Metabolism

Nucleic Acid Structure

DNA Replication, repair and Recombination

Transcription and Rna Processing

Regulation of Gene Expression

Filters

Which of following best describes the process for attachment of amino acid to the appropriate tRNAs? (Note: AA = amino acid,P_i = phosphate,PP_i = pyrophosphate)