Question 1

The genetic code is ________,which means that all cells use the same code.

Accepted Answer

The answer of The genetic code is ________,which means that...

Question 2

A researcher finds a molecule that is made of nucleotides and has a single amino acid bound to one end.This molecule is most likely a ________ molecule.

Accepted Answer

The answer of A researcher finds a molecule that is...

Question 3

The key enzyme used during transcription is

Accepted Answer

A)  RNA polymerase. 
B)  DNA polymerase. 
C)  rRNA. 
D)  terminase. 
A)  RNA polymerase. 
B)  DNA polymerase. 
C)  rRNA. 
D)  terminase.

Question 4

Which of the following is a codon?

Accepted Answer

A)  U 
B)  UU 
C)  UUU 
D)  UUUU 
A)  U 
B)  UU 
C)  UUU 
D)  UUUU

Question 5

The codon GAU codes for which amino acid?

Accepted Answer

A)  CUA 
B)  CTA 
C)  aspartate 
D)  leucine 
A)  CUA 
B)  CTA 
C)  aspartate 
D)  leucine

Question 6

Prokaryotes lack membrane-enclosed organelles and thus do not have nuclei.Therefore,prokaryotic

Accepted Answer

A)  cells are unable to undergo transcription and translation. 
B)  cells do not need to undergo translation. 
C)  cells do not need to undergo transcription. 
D)  transcription and translation both take place in the cytoplasm. 
A)  cells are unable to undergo transcription and translation. 
B)  cells do not need to undergo translation. 
C)  cells do not need to undergo transcription. 
D)  transcription and translation both take place in the cytoplasm.

Question 7

Which molecules are involved in translation?

Accepted Answer

A)  DNA and RNA 
B)  mDNA, tDNA, and rDNA 
C)  mRNA, tRNA, and rRNA 
D)  proteins, amino acids, and DNA 
A)  DNA and RNA 
B)  mDNA, tDNA, and rDNA 
C)  mRNA, tRNA, and rRNA 
D)  proteins, amino acids, and DNA

Question 8

Which of the following is true of rRNA?

Accepted Answer

A)  It is made up of base pairs. 
B)  It carries amino acids. 
C)  It is not translated. 
D)  It helps transcribe DNA. 
A)  It is made up of base pairs. 
B)  It carries amino acids. 
C)  It is not translated. 
D)  It helps transcribe DNA.

Question 9

Determine whether each molecule plays a role in transcription,translation,or both.
-amino acids

Accepted Answer

A) transcription 
B) translation 
C) both transcription and translation 
A) transcription 
B) translation 
C) both transcription and translation

Question 10

In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result,

Accepted Answer

A)  more mRNA for aromatase is produced. 
B)  less mRNA for aromatase is produced. 
C)  the production of aromatase is inhibited. 
D)  aromatase is degraded by other enzymes in the cell. 
A)  more mRNA for aromatase is produced. 
B)  less mRNA for aromatase is produced. 
C)  the production of aromatase is inhibited. 
D)  aromatase is degraded by other enzymes in the cell.

Question 11

Put the following steps in the process of translation in chronological order.
-A stop codon is reached.

Accepted Answer

A) first 
B) second 
C) third 
D) fourth 
E) fifth 
A) first 
B) second 
C) third 
D) fourth 
E) fifth

Question 12

Match the steps of transcription and translation to the location they take place within a eukaryotic cell.
-formation of a covalent bond between amino acids

Accepted Answer

A) nucleus 
B) cytoplasm 
A) nucleus 
B) cytoplasm

Question 13

Which of the following mutations would be more detrimental to an organism: 1)a mutation that changes the codon GGU to GGA,or 2)a mutation that changes the codon AAU to AAA? Defend your choice.

Accepted Answer

A mutation that changes the codon GGU to

Question 14

DNA technology can be used with all organisms because they all

Accepted Answer

A)  contain antibodies. 
B)  can contract the same diseases. 
C)  share the same chemical DNA structure. 
D)  contain the same genes. 
A)  contain antibodies. 
B)  can contract the same diseases. 
C)  share the same chemical DNA structure. 
D)  contain the same genes.

Question 15

Determine whether each molecule plays a role in transcription,translation,or both.
-mRNA

Accepted Answer

A) transcription 
B) translation 
C) both transcription and translation 
A) transcription 
B) translation 
C) both transcription and translation

Question 16

A protein that binds to the ________ of DNA down-regulates protein production by inhibiting the binding of RNA polymerase.

Accepted Answer

The answer of A protein that binds to the ________...

Question 17

Which of the following codons does NOT code for an amino acid?

Accepted Answer

A)  UGA 
B)  AUG 
C)  GAU 
D)  UAC 
A)  UGA 
B)  AUG 
C)  GAU 
D)  UAC

Question 18

A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so,what are the sequences of mRNA and DNA? If not,why not?

Accepted Answer

There is only one codon that codes for t

Question 19

Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA?

Accepted Answer

A)  tyrosine-tyrosine-alanine 
B)  tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine 
C)  methionine-proline-glutamate 
D)  methionine-proline-glutamate-isoleucine-alanine 
A)  tyrosine-tyrosine-alanine 
B)  tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine 
C)  methionine-proline-glutamate 
D)  methionine-proline-glutamate-isoleucine-alanine

Question 20

If a strand of DNA has the sequence CGTAA,the RNA made from this molecule will have the sequence

Accepted Answer

A)  CGTAA. 
B)  GCUTT. 
C)  TAGCC. 
D)  GCAUU. 
A)  CGTAA. 
B)  GCUTT. 
C)  TAGCC. 
D)  GCAUU.

Exam 10: How Genes Work

The genetic code is ________,which means that all cells use the same code.

A researcher finds a molecule that is made of nucleotides and has a single amino acid bound to one end.This molecule is most likely a ________ molecule.

The key enzyme used during transcription is

Which of the following is a codon?

The codon GAU codes for which amino acid?

Prokaryotes lack membrane-enclosed organelles and thus do not have nuclei.Therefore,prokaryotic

Which molecules are involved in translation?

Which of the following is true of rRNA?

Determine whether each molecule plays a role in transcription,translation,or both. -amino acids

In humans,the herbicide atrazine helps RNA polymerase bind to the promoter of the gene for the enzyme aromatase.As a result,

Put the following steps in the process of translation in chronological order. -A stop codon is reached.

Match the steps of transcription and translation to the location they take place within a eukaryotic cell. -formation of a covalent bond between amino acids

Which of the following mutations would be more detrimental to an organism: 1)a mutation that changes the codon GGU to GGA,or 2)a mutation that changes the codon AAU to AAA? Defend your choice.

DNA technology can be used with all organisms because they all

Determine whether each molecule plays a role in transcription,translation,or both. -mRNA

A protein that binds to the ________ of DNA down-regulates protein production by inhibiting the binding of RNA polymerase.

Which of the following codons does NOT code for an amino acid?

A short segment of a protein contains the following sequence of amino acids: tryptophan-valine-glycine.Can you determine the sequences of the mRNA and DNA used to produce this sequence? If so,what are the sequences of mRNA and DNA? If not,why not?

Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA?

If a strand of DNA has the sequence CGTAA,the RNA made from this molecule will have the sequence

The Nature of Science

Evaluating Scientific Claims

Chemistry of Life

Life Is Cellular

How Cells Work

Cell Division

Patterns of Inheritance

Chromosomes and Human Genetics

What Genes Are

Evidence for Evolution

Mechanisms of Evolution

Adaptation and Species

The History of Life

Bacteria and Archaea

Plants, Fungi, and Protists

Animals and Human Evolution

General Principles of Ecology

Growth of Populations

Communities of Organisms

Ecosystems

Filters