Multiple Choice
Using the following chart,what chain of amino acids would be produced by the sequence of this very short,complete gene: UAUUAUGCCUGAGUGAAUUGCUA? 
A) tyrosine-tyrosine-alanine
B) tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine
C) methionine-proline-glutamate
D) methionine-proline-glutamate-isoleucine-alanine
Correct Answer:
Verified
Correct Answer:
Verified
Q42: If a strand of DNA has the
Q60: As transcription begins,RNA polymerase binds to a
Q61: Matching Questions<br>match each nucleic acid with its
Q74: DNA technology can be used with all
Q76: A protein that binds to the _
Q77: Which of the following codons does NOT
Q78: A short segment of a protein contains
Q81: Match the descriptions to the molecules of
Q83: Identify if the following situations represent an
Q84: In the genetic code,a codon is _