Question 1

The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.

Accepted Answer

A) True 
 B)False

Question 2

61 different tRNAs are required for translation in vivo.

Accepted Answer

A) True 
 B)False

Question 3

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

Accepted Answer

A)  8 
B)  9 
C)  10 
D)  11 
A)  8 
B)  9 
C)  10 
D)  11

Question 4

The scientist(s)________ studied patients who had defects in their ability to metabolize certain compounds,particularly the inherited disease alkaptonuria.He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

Accepted Answer

A)  Garrod 
B)  Nirenberg and Matthaei 
C)  Khorana and colleagues 
D)  Nirenberg and Leder 
E)  Beadle and Tatum 
A)  Garrod 
B)  Nirenberg and Matthaei 
C)  Khorana and colleagues 
D)  Nirenberg and Leder 
E)  Beadle and Tatum

Question 5

During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Accepted Answer

A) True 
 B)False

Question 6

Based on our modern understanding,what revisions are necessary to the original one-gene / one-enzyme hypothesis?

Accepted Answer

A)  Alternative splicing allows one gene to encode multiple polypeptides. 
B)  Some genes encode RNAs, not enzymes. 
C)  Some genes encode lipids, not enzymes. 
D)  Some genes encode polypeptides that are not enzymes, such as structural proteins. 
E)  Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein. 
A)  Alternative splicing allows one gene to encode multiple polypeptides. 
B)  Some genes encode RNAs, not enzymes. 
C)  Some genes encode lipids, not enzymes. 
D)  Some genes encode polypeptides that are not enzymes, such as structural proteins. 
E)  Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein.

Question 7

The wobble base is the second base of a codon.

Accepted Answer

A) True 
 B)False

Question 8

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Accepted Answer

A)  1 
B)  2 
C)  3 
D)  4 
A)  1 
B)  2 
C)  3 
D)  4

Question 9

Proteins that are composed of two or more polypeptides are said to have quaternary structure.

Accepted Answer

A) True 
 B)False

Question 10

Which molecule contains an anticodon?

Accepted Answer

A)  DNA 
B)  mRNA 
C)  rRNA 
D)  tRNA 
E)  snRNA 
A)  DNA 
B)  mRNA 
C)  rRNA 
D)  tRNA 
E)  snRNA

Question 11

What site on the ribosome is primarily responsible for holding the growing polypeptide?

Accepted Answer

A)  A 
B)  E 
C)  P 
A)  A 
B)  E 
C)  P

Question 12

Where are the ribosomal subunits assembled?

Accepted Answer

A)  nucleus 
B)  nucleoid 
C)  nucleolus 
D)  nuclear envelope 
A)  nucleus 
B)  nucleoid 
C)  nucleolus 
D)  nuclear envelope

The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.

61 different tRNAs are required for translation in vivo.

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

The scientist(s)________ studied patients who had defects in their ability to metabolize certain compounds,particularly the inherited disease alkaptonuria.He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Based on our modern understanding,what revisions are necessary to the original one-gene / one-enzyme hypothesis?

The wobble base is the second base of a codon.

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Proteins that are composed of two or more polypeptides are said to have quaternary structure.

Which molecule contains an anticodon?

What site on the ribosome is primarily responsible for holding the growing polypeptide?

Where are the ribosomal subunits assembled?

Overview of Genetics

Reproduction and Chromosome Transmission

Mendelian Inheritance

Sex Determination and Sex Chromosomes

Extensions of Mendelian Inheritance

Extranuclear Inheritance, Imprinting, and Maternal Effect

Genetic Linkage and Mapping in Eukaryotes

Variation in Chromosome Structure and Number

Genetics in Bacteria

Genetics of Viruses

Molecular Structure of DNA and RNA

Molecular Structure of Chromosomes and Transposition

Dna Replication and Recombination

Gene Transcription and RNA Modification

Gene Regulation in Bacteria

Gene Regulation in Eukaryotes

Non-Coding Rnas

Gene Mutation and DNA Repair

Molecular Technologies

Genomics

Medical Genetics and Cancer

Population Genetics

Quantitative Genetics

Filters

Exam 15: Translation of MRNA

The one-gene,one-enzyme hypothesis was first proposed by Beadle and Tatum.

61 different tRNAs are required for translation in vivo.

How many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′

The scientist(s)________ studied patients who had defects in their ability to metabolize certain compounds,particularly the inherited disease alkaptonuria.He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

During elongation,the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Based on our modern understanding,what revisions are necessary to the original one-gene / one-enzyme hypothesis?

The wobble base is the second base of a codon.

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Proteins that are composed of two or more polypeptides are said to have quaternary structure.

Which molecule contains an anticodon?

What site on the ribosome is primarily responsible for holding the growing polypeptide?

Where are the ribosomal subunits assembled?

Overview of Genetics

Reproduction and Chromosome Transmission

Mendelian Inheritance

Sex Determination and Sex Chromosomes

Extensions of Mendelian Inheritance

Extranuclear Inheritance, Imprinting, and Maternal Effect

Genetic Linkage and Mapping in Eukaryotes

Variation in Chromosome Structure and Number

Genetics in Bacteria

Genetics of Viruses

Molecular Structure of DNA and RNA

Molecular Structure of Chromosomes and Transposition

Dna Replication and Recombination

Gene Transcription and RNA Modification

Gene Regulation in Bacteria

Gene Regulation in Eukaryotes

Non-Coding Rnas

Gene Mutation and DNA Repair

Molecular Technologies

Genomics

Medical Genetics and Cancer

Population Genetics

Quantitative Genetics

Filters