Question 1

By definition, exergonic reaction has:

Accepted Answer

A)  ΔG= positive value 
B)  ΔG= negative value 
C)  ΔH= positive value 
D)  ΔH= negative value 
E)  ΔS = positive value 
A)  ΔG= positive value 
B)  ΔG= negative value 
C)  ΔH= positive value 
D)  ΔH= negative value 
E)  ΔS = positive value B

Question 2

Which of the following represents an INCORRECT breakdown sequence for that food?

Accepted Answer

A)  carbohydrates - polysaccharides - coenzyme A 
B)  starch - maltose and dextrins - maltose - glucose 
C)  protein - polypeptides - small peptides - amino acids 
D)  fats and oils - glycerol, glycerides, and fatty acids - fatty acids to CO2 and water 
E)  fats and oils - glycerol, glycerides, and fatty acids - glycerol to triose phosphate 
A)  carbohydrates - polysaccharides - coenzyme A 
B)  starch - maltose and dextrins - maltose - glucose 
C)  protein - polypeptides - small peptides - amino acids 
D)  fats and oils - glycerol, glycerides, and fatty acids - fatty acids to CO2 and water 
E)  fats and oils - glycerol, glycerides, and fatty acids - glycerol to triose phosphate A

Question 3

A typical E. coli bacterium is a cylindrical cell about 2 μm long and 1 μm in diameter, weighing about 1.8 × 10-12 g and containing 80% water by volume. Calculate the number of lipid molecules present, assuming their average molecular weight is 688 and the lipid content is 1.9%.

Accepted Answer

A)  8.3 × 1010 
B)  2.1 × 1010 
C)  2.4 × 107 
D)  1.6 × 109 
E)  3.0 × 107 
A)  8.3 × 1010 
B)  2.1 × 1010 
C)  2.4 × 107 
D)  1.6 × 109 
E)  3.0 × 107 E

Question 4

The artificial sweetener Nutrasweet® (aspartame) is not a derivative of sugar, but is actually a small dipeptide. What two amino acids make up the basic structure of Nutrasweet®?

Accepted Answer

A)  glutamic acid and phenylalanine 
B)  asparagine and tyrosine 
C)  aspartic acid and phenylalanine 
D)  serine and glycine 
E)  aspartic acid and tryptophan 
A)  glutamic acid and phenylalanine 
B)  asparagine and tyrosine 
C)  aspartic acid and phenylalanine 
D)  serine and glycine 
E)  aspartic acid and tryptophan

Question 5

Which of the following is unimportant for tertiary structure of the proteins?

Accepted Answer

A)  peptide bonds 
B)  salt linkages 
C)  hydrogen bonding 
D)  disulfide linkages 
A)  peptide bonds 
B)  salt linkages 
C)  hydrogen bonding 
D)  disulfide linkages

Question 6

Compounds which are optical isomers of one another but differ in physical and chemical properties are known as what?

Accepted Answer

A)  geometric isomers 
B)  enantiomers 
C)  racemic compounds 
D)  allotropes 
E)  diastereomers 
A)  geometric isomers 
B)  enantiomers 
C)  racemic compounds 
D)  allotropes 
E)  diastereomers

Question 7

The molecule on which an enzyme acts is commonly referred to as:

Accepted Answer

A)  reactant 
B)  substrate 
C)  hydrolate 
D)  active site 
E)  actor 
A)  reactant 
B)  substrate 
C)  hydrolate 
D)  active site 
E)  actor

Question 8

What is the direction of migration of the amino acid phenylalanine in a gel that is 0.25 M in NaH2PO4 and 0.50 M in Na2HPO4? For phenylalanine, pI = 5.74.

Accepted Answer

Question 9

ΔG° = -2880 kJ/mole for the oxidation of glucose (C6H12O6). What is ΔG° for the oxidation of 3.45 grams of glucose?

Accepted Answer

A)  -342 kJ 
B)  -55.2 kJ 
C)  -0.215 kJ 
D)  -9.94 × 103 kJ 
E)  -621 kJ 
A)  -342 kJ 
B)  -55.2 kJ 
C)  -0.215 kJ 
D)  -9.94 × 103 kJ 
E)  -621 kJ

Question 10

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand? ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

Accepted Answer

A)  GCCATATCCGCCTATACCGGGAATTCTCAGCA 
B)  CGGTATAGGCGGATATGGCCCTTAAGAGTCGT 
C)  ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT 
D)  TAAGCGCAATAACGCGAATTTCCGGAGAGTAG 
E)  TAACGCGAATAAGCGCAATTTCCGGAGACTAC 
A)  GCCATATCCGCCTATACCGGGAATTCTCAGCA 
B)  CGGTATAGGCGGATATGGCCCTTAAGAGTCGT 
C)  ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT 
D)  TAAGCGCAATAACGCGAATTTCCGGAGAGTAG 
E)  TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 11

Which molecule is optically active?

Accepted Answer

A)  2-chlorobutane 
B)  1-chlorobutane 
C)  trans-propene 
D)  cis-propene 
A)  2-chlorobutane 
B)  1-chlorobutane 
C)  trans-propene 
D)  cis-propene

Question 12

Cellulose and starch are both polymers of glucose units, but most animals can only use starch as a source of carbohydrate in their diets. Why are most animals incapable of digesting cellulose?

Accepted Answer

A)  Starch contains α linkages between carbons 1 and 4, where as cellulose contains β linkages between carbons 1 and 2. 
B)  This statement is incorrect. Most animals can digest cellulose. 
C)  The polymer of cellulose is simply too long to be completely digested by animals. 
D)  Most animals do not produce enzymes which are capable of hydrolyzing β linkages between glycoses. 
E)  The glucose units of cellulose are in the open chain form and cannot be hydrolyzed by the cyclic-sugar specific enzymes of animals. 
A)  Starch contains α linkages between carbons 1 and 4, where as cellulose contains β linkages between carbons 1 and 2. 
B)  This statement is incorrect. Most animals can digest cellulose. 
C)  The polymer of cellulose is simply too long to be completely digested by animals. 
D)  Most animals do not produce enzymes which are capable of hydrolyzing β linkages between glycoses. 
E)  The glucose units of cellulose are in the open chain form and cannot be hydrolyzed by the cyclic-sugar specific enzymes of animals.

Question 13

What is the common name of the following triglyceride?

Accepted Answer

A)  glyceryl myristolaurolinoleneate 
B)  glyceryl palmitostearooleate 
C)  glycero laurostearooleate 
D)  glycero palmitostearooleate 
E)  glyco stearooleolaurate 
A)  glyceryl myristolaurolinoleneate 
B)  glyceryl palmitostearooleate 
C)  glycero laurostearooleate 
D)  glycero palmitostearooleate 
E)  glyco stearooleolaurate

Question 14

At the isoelectric point, an amino acid has what charges?

Accepted Answer

A)  + and - 
B)  none 
C)  + only 
D)  - only 
E)  multiple charges 
A)  + and - 
B)  none 
C)  + only 
D)  - only 
E)  multiple charges

Question 15

The R group -CH3 belongs to which amino acid?

Accepted Answer

A)  glycine 
B)  lysine 
C)  proline 
D)  alanine 
E)  histidine 
A)  glycine 
B)  lysine 
C)  proline 
D)  alanine 
E)  histidine

Question 16

Choose the INCORRECT statement.

Accepted Answer

A)  The bond between amino acids is called a peptide bond. 
B)  There are four levels of structure in a protein. 
C)  Primary structure is the order of the amino acids in the chain. 
D)  Secondary structure is the bonding of more than one protein together. 
E)  Enzymes are biological catalysts that contain protein. 
A)  The bond between amino acids is called a peptide bond. 
B)  There are four levels of structure in a protein. 
C)  Primary structure is the order of the amino acids in the chain. 
D)  Secondary structure is the bonding of more than one protein together. 
E)  Enzymes are biological catalysts that contain protein.

Question 17

Saponification of 1 mole of glyceryl dibutyrooleate with excess potassium hydroxide would yield which of the following products?

Accepted Answer

A)  2 moles of potassium butyrate, 1 mole of potassium oleate 
B)  1 mole of glycerol, 1 mole of potassium oleate, 2 moles of potassium butyrate 
C)  2 moles of potassium butyrate 
D)  1 mole of glycerol, 2 moles of butyraldehyde, 1 mole of olealdehyde 
E)  1 mole of glycerol, 1 mole of potassium decanoate, 2 moles of potassium butyrate 
A)  2 moles of potassium butyrate, 1 mole of potassium oleate 
B)  1 mole of glycerol, 1 mole of potassium oleate, 2 moles of potassium butyrate 
C)  2 moles of potassium butyrate 
D)  1 mole of glycerol, 2 moles of butyraldehyde, 1 mole of olealdehyde 
E)  1 mole of glycerol, 1 mole of potassium decanoate, 2 moles of potassium butyrate

Question 18

Choose the INCORRECT statement.

Accepted Answer

A)  Proteins make up the bulk of the body's nonskeletal structure. 
B)  Enzymes are carbohydrates which speed up reactions. 
C)  Except glycine, naturally occurring amino acids are optically active. 
D)  Essential amino acids are necessary for proper health and growth. 
E)  Essential amino acids must be ingested through foods because the body is unable to synthesize them. 
A)  Proteins make up the bulk of the body's nonskeletal structure. 
B)  Enzymes are carbohydrates which speed up reactions. 
C)  Except glycine, naturally occurring amino acids are optically active. 
D)  Essential amino acids are necessary for proper health and growth. 
E)  Essential amino acids must be ingested through foods because the body is unable to synthesize them.

Question 19

Choose the INCORRECT statement.

Accepted Answer

A)  Amino acids can exist as dipolar ions. 
B)  Dipolar ions are also called zwitterion. 
C)  Isoelectric point is the pH at which an amino acid becomes a cation. 
D)  Two amino acids joined by the elimination of a water molecule is a dipeptide. 
E)  A large polypeptide of more than 10,000 U is called a protein. 
A)  Amino acids can exist as dipolar ions. 
B)  Dipolar ions are also called zwitterion. 
C)  Isoelectric point is the pH at which an amino acid becomes a cation. 
D)  Two amino acids joined by the elimination of a water molecule is a dipeptide. 
E)  A large polypeptide of more than 10,000 U is called a protein.

Question 20

Choose the INCORRECT statement.

Accepted Answer

A)  Lipids are hydrocarbons with basic properties. 
B)  The acyl groups of triglycerides are fatty acids. 
C)  A mixed triglyceride has different acyl groups. 
D)  Lipids are constituents of plant and animal tissues that are soluble in solvents of low polarity. 
E)  Triglycerides are esters of glycerol with long-chain monocarboxylic acids. 
A)  Lipids are hydrocarbons with basic properties. 
B)  The acyl groups of triglycerides are fatty acids. 
C)  A mixed triglyceride has different acyl groups. 
D)  Lipids are constituents of plant and animal tissues that are soluble in solvents of low polarity. 
E)  Triglycerides are esters of glycerol with long-chain monocarboxylic acids.

Exam 28: Chemistry of the Living State

By definition, exergonic reaction has:

Which of the following represents an INCORRECT breakdown sequence for that food?

A typical E. coli bacterium is a cylindrical cell about 2 μm long and 1 μm in diameter, weighing about 1.8 × 10-12 g and containing 80% water by volume. Calculate the number of lipid molecules present, assuming their average molecular weight is 688 and the lipid content is 1.9%.

The artificial sweetener Nutrasweet® (aspartame) is not a derivative of sugar, but is actually a small dipeptide. What two amino acids make up the basic structure of Nutrasweet®?

Which of the following is unimportant for tertiary structure of the proteins?

Compounds which are optical isomers of one another but differ in physical and chemical properties are known as what?

The molecule on which an enzyme acts is commonly referred to as:

What is the direction of migration of the amino acid phenylalanine in a gel that is 0.25 M in NaH2PO4 and 0.50 M in Na2HPO4? For phenylalanine, pI = 5.74.

ΔG° = -2880 kJ/mole for the oxidation of glucose (C6H12O6). What is ΔG° for the oxidation of 3.45 grams of glucose?

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand? ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

Which molecule is optically active?

Cellulose and starch are both polymers of glucose units, but most animals can only use starch as a source of carbohydrate in their diets. Why are most animals incapable of digesting cellulose?

What is the common name of the following triglyceride?

At the isoelectric point, an amino acid has what charges?

The R group -CH3 belongs to which amino acid?

Choose the INCORRECT statement.

Saponification of 1 mole of glyceryl dibutyrooleate with excess potassium hydroxide would yield which of the following products?

Choose the INCORRECT statement.

Choose the INCORRECT statement.

Choose the INCORRECT statement.

Matter - Its Properties and Measurement

Atoms and the Atomic Theory

Chemical Compounds

Chemical Reactions

Introduction to Reactions in Aqueous Solutions

Gases

Thermochemistry

Electrons in Atoms

The Periodic Table and Some Atomic Properties

Chemical Bonding I: Basic Concepts

Chemical Bonding II: Additional Aspects

Intermolecular Forces: Liquids and Solids

Solutions and Their Physical Properties

Chemical Kinetics

Principles of Chemical Equilibrium

Acids and Bases

Additional Aspects of Acid-Base Equilibria

Solubility and Complex-Ion Equilibria

Spontaneous Change: Entropy and Free Energy

Electrochemistry

Main Group Elements I: Groups 1, 2, 13, and 14

Main Group Elements II: Groups 18, 17, 16, 15, and Hydrogen

The Transition Elements

Complex Ions and Coordination Compounds

Nuclear Chemistry 1-41

Structures of Organic Compounds

Reactions of Organic Compounds

Filters

A typical E. coli bacterium is a cylindrical cell about 2 μm long and 1 μm in diameter, weighing about 1.8 × 10^-12 g and containing 80% water by volume. Calculate the number of lipid molecules present, assuming their average molecular weight is 688 and the lipid content is 1.9%.

What is the direction of migration of the amino acid phenylalanine in a gel that is 0.25 M in NaH₂PO₄ and 0.50 M in Na₂HPO₄? For phenylalanine, pI = 5.74.

ΔG° = -2880 kJ/mole for the oxidation of glucose (C₆H₁₂O₆). What is ΔG° for the oxidation of 3.45 grams of glucose?

The R group -CH₃ belongs to which amino acid?