Question 1

A cDNA library differs from a genomic library in which way?

Accepted Answer

A)  It consists solely of RNA molecules. 
B)  It contains many copies of the gene of interest. 
C)  It contains only coding sequences, not introns. 
D)  It is typically 10-100 times the size of a DNA library. 
A)  It consists solely of RNA molecules. 
B)  It contains many copies of the gene of interest. 
C)  It contains only coding sequences, not introns. 
D)  It is typically 10-100 times the size of a DNA library.

Question 2

What do competent cells do?

Accepted Answer

A)  resist transfection by a viral vector 
B)  rejoin DNA strands without the aid of DNA ligase 
C)  utilize transposons as a vector 
D)  take up DNA from the external environment 
A)  resist transfection by a viral vector 
B)  rejoin DNA strands without the aid of DNA ligase 
C)  utilize transposons as a vector 
D)  take up DNA from the external environment

Question 3

Site-directed mutagenesis allows researchers to produce a mutation at a ________ within a cloned DNA segment.

Accepted Answer

A)  specific site 
B)  random site 
C)  semilocalized site that can later be identified by sequencing 
A)  specific site 
B)  random site 
C)  semilocalized site that can later be identified by sequencing

Question 4

cDNA is made using what as the starting material?

Accepted Answer

A)  plasmid vectors 
B)  viral DNA 
C)  chromosomal DNA 
D)  RNA 
A)  plasmid vectors 
B)  viral DNA 
C)  chromosomal DNA 
D)  RNA

Question 5

Select the reagents needed for PCR.Choose all that apply.

Accepted Answer

A)  Template DNA 
B)  Primers 
C)  dNTPs 
D)  DNA Polymerase 
E)  RNA 
A)  Template DNA 
B)  Primers 
C)  dNTPs 
D)  DNA Polymerase 
E)  RNA

Question 6

Which technique is best suited to identify DNA-protein interactions?

Accepted Answer

A)  Western blotting 
B)  PCR 
C)  gel mobility shift assay 
D)  restriction enzyme analysis 
A)  Western blotting 
B)  PCR 
C)  gel mobility shift assay 
D)  restriction enzyme analysis

Question 7

Although Dolly was only three years old,her chromosomes had the length of a 9- to 10-year-old sheep.Which of the following best describes why this occurred?

Accepted Answer

A)  The cell lines that created Dolly were aged prematurely in the lab and thus became longer. 
B)  Nonhomologous recombination occurred, which caused Dolly's chromosomes to shorten. 
C)  A mutation enhanced the rate of aging of Dolly's chromosomes. 
D)  Dolly was not a clone. 
E)  The telomeres of the somatic cells that Dolly originated from were already shortening. 
A)  The cell lines that created Dolly were aged prematurely in the lab and thus became longer. 
B)  Nonhomologous recombination occurred, which caused Dolly's chromosomes to shorten. 
C)  A mutation enhanced the rate of aging of Dolly's chromosomes. 
D)  Dolly was not a clone. 
E)  The telomeres of the somatic cells that Dolly originated from were already shortening.

Question 8

Select the technique that can be used to see how a specific mutation affects the expression of a gene and the function of a protein.

Accepted Answer

A)  site-directed mutagenesis 
B)  Western blotting 
C)  real-time PCR 
D)  DNA sequencing 
A)  site-directed mutagenesis 
B)  Western blotting 
C)  real-time PCR 
D)  DNA sequencing

Question 9

Detection of a product in real-time PCR depends on

Accepted Answer

A)  the separation of the reporter from the quencher. 
B)  the reporter and quencher remaining in close proximity to each other. 
C)  the reporter binding to the quencher. 
D)  Taq polymerase destroying the reporter. 
A)  the separation of the reporter from the quencher. 
B)  the reporter and quencher remaining in close proximity to each other. 
C)  the reporter binding to the quencher. 
D)  Taq polymerase destroying the reporter.

Question 10

Which of the following terms describes a cell that can form any other cell of the organism?

Accepted Answer

A)  pluripotent 
B)  totipotent 
C)  unipotent 
D)  All of the answers are correct. 
A)  pluripotent 
B)  totipotent 
C)  unipotent 
D)  All of the answers are correct.

Question 11

You are performing a mobility shift assay with a protein complex that is composed of proteins A,B,C,& D,each of which can bind to the DNA of interest.You run the gel with the lanes as follows:
Lane 1: Protein A + DNA
Lane 2: Proteins A + B + DNA
Lane 3: Proteins A + B + C + DNA
Lane 4: Proteins A + B + C + D + DNA
In which lane will the DNA run closest to the top of the gel?

Accepted Answer

A)  Lane 4 
B)  Lane 3 
C)  Lane 2 
D)  Lane 1 
A)  Lane 4 
B)  Lane 3 
C)  Lane 2 
D)  Lane 1

Question 12

Restriction endonucleases recognize specific DNA sequences.

Accepted Answer

A) True 
 B)False

Question 13

Which of the following would contain both vector DNA and chromosomal DNA?

Accepted Answer

A)  recircularized vector 
B)  hybrid vector 
C)  both vectors 
D)  neither vector 
A)  recircularized vector 
B)  hybrid vector 
C)  both vectors 
D)  neither vector

Question 14

What is the purpose of RNaseH in the making of cDNA?

Accepted Answer

A)  It copies the RNA into a complementary DNA strand. 
B)  It reforms the sugar-phosphate backbone. 
C)  It generates short RNAs that are used as primers. 
D)  It proofreads the cDNA for errors. 
A)  It copies the RNA into a complementary DNA strand. 
B)  It reforms the sugar-phosphate backbone. 
C)  It generates short RNAs that are used as primers. 
D)  It proofreads the cDNA for errors.

Question 15

In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you wish to use site-directed mutagenesis to change the T at position 8 to a C.Select the primer that is likely to give you the best results.

Accepted Answer

A)  5′ GCGCAAACTTCCCTATACCC 3′ 
B)  5′ CGCGTTTGAAGGATATGGG 3′ 
C)  5′ GCGCAGGCCTCCCTATACCC 3′ 
A)  5′ GCGCAAACTTCCCTATACCC 3′ 
B)  5′ CGCGTTTGAAGGATATGGG 3′ 
C)  5′ GCGCAGGCCTCCCTATACCC 3′

Question 16

Which of the following is an example of a palindromic DNA sequence?

Accepted Answer

A)  5′ - ATCGAC - 3′ 3′ - TAGCAG - 5′ 
B)  5′ - ATCATC - 3′ 3′ - ATCATC - 5′ 
C)  5′ - GCCGCC - 3′ 3′ - CGGCGG - 5′ 
D)  5′ - CTGCAG - 3′ 3′ - GACGTC - 5′ 
A)  5′ - ATCGAC - 3′ 3′ - TAGCAG - 5′ 
B)  5′ - ATCATC - 3′ 3′ - ATCATC - 5′ 
C)  5′ - GCCGCC - 3′ 3′ - CGGCGG - 5′ 
D)  5′ - CTGCAG - 3′ 3′ - GACGTC - 5′

Question 17

Bone marrow transplants typically use what type of cells?

Accepted Answer

A)  embryonic stem cells 
B)  embryonic germ cells 
C)  hematopoietic stem cells 
D)  None of the answers are correct. 
A)  embryonic stem cells 
B)  embryonic germ cells 
C)  hematopoietic stem cells 
D)  None of the answers are correct.

Question 18

Unipotent cells may differentiate into all other cell types of the body.

Accepted Answer

A) True 
 B)False

Question 19

Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called ________.

Accepted Answer

A)  phages 
B)  viruses 
C)  plasmids 
D)  chromosomes 
A)  phages 
B)  viruses 
C)  plasmids 
D)  chromosomes

Question 20

Which of the following cells are pluripotent? (Check all that apply)

Accepted Answer

A)  embryonic stem cells 
B)  embryonic germ cells 
C)  neuronal cells 
D)  epithelial cells 
E)  red blood cells 
A)  embryonic stem cells 
B)  embryonic germ cells 
C)  neuronal cells 
D)  epithelial cells 
E)  red blood cells

Exam 20: Molecular Technologies

A cDNA library differs from a genomic library in which way?

What do competent cells do?

Site-directed mutagenesis allows researchers to produce a mutation at a ________ within a cloned DNA segment.

cDNA is made using what as the starting material?

Select the reagents needed for PCR.Choose all that apply.

Which technique is best suited to identify DNA-protein interactions?

Although Dolly was only three years old,her chromosomes had the length of a 9- to 10-year-old sheep.Which of the following best describes why this occurred?

Select the technique that can be used to see how a specific mutation affects the expression of a gene and the function of a protein.

Detection of a product in real-time PCR depends on

Which of the following terms describes a cell that can form any other cell of the organism?

Restriction endonucleases recognize specific DNA sequences.

Which of the following would contain both vector DNA and chromosomal DNA?

What is the purpose of RNaseH in the making of cDNA?

In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′,you wish to use site-directed mutagenesis to change the T at position 8 to a C.Select the primer that is likely to give you the best results.

Which of the following is an example of a palindromic DNA sequence?

Bone marrow transplants typically use what type of cells?

Unipotent cells may differentiate into all other cell types of the body.

Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called ________.

Which of the following cells are pluripotent? (Check all that apply)

Overview of Genetics

Reproduction and Chromosome Transmission

Mendelian Inheritance

Sex Determination and Sex Chromosomes

Extensions of Mendelian Inheritance

Extranuclear Inheritance, Imprinting, and Maternal Effect

Genetic Linkage and Mapping in Eukaryotes

Variation in Chromosome Structure and Number

Genetics in Bacteria

Genetics of Viruses

Molecular Structure of DNA and RNA

Molecular Structure of Chromosomes and Transposition

Dna Replication and Recombination

Gene Transcription and RNA Modification

Translation of MRNA

Gene Regulation in Bacteria

Gene Regulation in Eukaryotes

Non-Coding Rnas

Gene Mutation and DNA Repair

Genomics

Medical Genetics and Cancer

Population Genetics

Quantitative Genetics

Filters