Question 1

Match between columns
                        Premises: sites for polypeptide assembly

Accepted Answer

The Answer of translation termination and genetic code and rRNA is...

Question 2

The master gene for male sex determination is located on _____.

Accepted Answer

A) both X chromosomes 
B) each autosome 
C) the Y chromosome 
D) the X chromosome 
E) both X and Y chromosomes 
A) both X chromosomes 
B) each autosome 
C) the Y chromosome 
D) the X chromosome 
E) both X and Y chromosomes

Question 3

Referring to the image above, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

Accepted Answer

A) asp-gly-val-glu-glu-trp-tyr 
B) leu-pro-glu-leu-leu-thr-ile 
C) ile-thr-leu-leu-gly-pro-leu 
D) ser-arg-arg-met-gly-val-stop 
E) met-gly-val-lys-ser-gly-stop 
A) asp-gly-val-glu-glu-trp-tyr 
B) leu-pro-glu-leu-leu-thr-ile 
C) ile-thr-leu-leu-gly-pro-leu 
D) ser-arg-arg-met-gly-val-stop 
E) met-gly-val-lys-ser-gly-stop

Question 4

What is at the center of a heme molecule in a hemoglobin protein?

Accepted Answer

A) a beta globin chain 
B) an alpha globin chain 
C) iron 
D) nitrogen 
E) another heme molecule 
A) a beta globin chain 
B) an alpha globin chain 
C) iron 
D) nitrogen 
E) another heme molecule

Question 5

Transcription _____.

Accepted Answer

A) uses both strands of DNA simultaneously as templates 
B) uses the enzyme DNA polymerase 
C) results in a double-stranded end product 
D) produces three different types of RNA molecules 
E) does not require the hydrogen bonds of DNA to be broken 
A) uses both strands of DNA simultaneously as templates 
B) uses the enzyme DNA polymerase 
C) results in a double-stranded end product 
D) produces three different types of RNA molecules 
E) does not require the hydrogen bonds of DNA to be broken

Question 6

Ricin is a toxin found in _____.

Accepted Answer

A) canola-oil seeds 
B) castor-oil seeds 
C) gypsum-weed seeds 
D) sesame seeds 
E) sunflower seeds 
A) canola-oil seeds 
B) castor-oil seeds 
C) gypsum-weed seeds 
D) sesame seeds 
E) sunflower seeds

Question 7

Which type of molecule is ricin?

Accepted Answer

A) protein 
B) lipid 
C) nucleic acid 
D) carbohydrate 
E) mineral 
A) protein 
B) lipid 
C) nucleic acid 
D) carbohydrate 
E) mineral

Question 8

Mutations in an intron region of a gene are most likely to _____.

Accepted Answer

A) prevent mRNA from being synthesized 
B) trap mRNA inside the nucleus 
C) prevent mRNA from being recognized by the ribosome 
D) result in no changes in the amino acid sequence 
E) alter the amino acid sequence 
A) prevent mRNA from being synthesized 
B) trap mRNA inside the nucleus 
C) prevent mRNA from being recognized by the ribosome 
D) result in no changes in the amino acid sequence 
E) alter the amino acid sequence

Question 9

Homeotic genes are, in general, in control of _____.

Accepted Answer

A) X chromosome inactivation 
B) formation of major body parts 
C) methylation of nucleotides 
D) dosage compensation 
E) sex determination 
A) X chromosome inactivation 
B) formation of major body parts 
C) methylation of nucleotides 
D) dosage compensation 
E) sex determination

Question 10

tRNA differs from other types of RNA because it _____.

Accepted Answer

A) acts as an enzyme 
B) is only involved in transcription 
C) binds to mRNA 
D) codes for multiple amino acids 
E) is complexed with a protein 
A) acts as an enzyme 
B) is only involved in transcription 
C) binds to mRNA 
D) codes for multiple amino acids 
E) is complexed with a protein

Question 11

Why are mutations uncommon in normal cells?

Accepted Answer

A) Only 25% of the genome codes for proteins, therefore the probability is low that a mutation would occur in a protein coding region. 
B) Most mutations occur after DNA replication. 
C) Many amino acids are coded for by more than one codon. 
D) The mutation rate during DNA replication is 1 in 100 nucleotides. 
E) The mutation rate during DNA replication is zero. 
A) Only 25% of the genome codes for proteins, therefore the probability is low that a mutation would occur in a protein coding region. 
B) Most mutations occur after DNA replication. 
C) Many amino acids are coded for by more than one codon. 
D) The mutation rate during DNA replication is 1 in 100 nucleotides. 
E) The mutation rate during DNA replication is zero.

Question 12

Match between columns
                        Premises: A deletion in the beta globin gene leads to this type of mutation, causing beta-thalassemia.

Accepted Answer

The Answer of Frame-shift mutation and Deletion only and Base-pair is...

Question 13

Epigenetic modifications _____.

Accepted Answer

A) are considered evolutionary 
B) are completely reset during development 
C) alter the DNA sequence 
D) can persist for generations 
E) respond less rapidly to environmental changes than altering the DNA sequence 
A) are considered evolutionary 
B) are completely reset during development 
C) alter the DNA sequence 
D) can persist for generations 
E) respond less rapidly to environmental changes than altering the DNA sequence

Question 14

Sphynx cats have a mutation in a(n)_____ of the keratin gene, which prevents necessary splicing; therefore, keratin protein fibers do not assemble properly.

Accepted Answer

A) promoter 
B) ​i ntron-exon splice site 
C) exon 
D) stop codon 
E) enhancer 
A) promoter 
B) ​i ntron-exon splice site 
C) exon 
D) stop codon 
E) enhancer

Question 15

Which mutation(s)may not result in an amino acid change in the protein product?

Accepted Answer

A) deletion and insertion 
B) deletion and substitution 
C) insertion and substitution 
D) substitution only 
E) insertion only 
A) deletion and insertion 
B) deletion and substitution 
C) insertion and substitution 
D) substitution only 
E) insertion only

Question 16

How many different codons are part of the genetic code?

Accepted Answer

A) 4 
B) 16 
C) 32 
D) 64 
E) 128 
A) 4 
B) 16 
C) 32 
D) 64 
E) 128

Question 17

Most of the energy required to form the peptide bonds during elongation comes from _____.

Accepted Answer

A) ATP 
B) CTP 
C) GTP 
D) TTP 
E) whichever nucleotide is at the front of the codon 
A) ATP 
B) CTP 
C) GTP 
D) TTP 
E) whichever nucleotide is at the front of the codon

Question 18

Ricin inactivates _____.

Accepted Answer

A) proteins 
B) ribosomes 
C) DNA 
D) transcription factors 
E) mRNA 
A) proteins 
B) ribosomes 
C) DNA 
D) transcription factors 
E) mRNA

Question 19

How much of the human genome actually codes for protein products?

Accepted Answer

A) 2% 
B) 26% 
C) 48% 
D) 71% 
E) 100% 
A) 2% 
B) 26% 
C) 48% 
D) 71% 
E) 100%

Question 20

Match between columns
                        Premises: guided and catalyzed by RNA polymerases

Accepted Answer

The Answer of messenger RNA and translation and ribosome and is...

Exam 7: Gene Expression and Control

The master gene for male sex determination is located on _____.

Referring to the image above, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

What is at the center of a heme molecule in a hemoglobin protein?

Transcription _____.

Ricin is a toxin found in _____.

Which type of molecule is ricin?

Mutations in an intron region of a gene are most likely to _____.

Homeotic genes are, in general, in control of _____.

tRNA differs from other types of RNA because it _____.

Why are mutations uncommon in normal cells?

Epigenetic modifications _____.

Sphynx cats have a mutation in a(n)_____ of the keratin gene, which prevents necessary splicing; therefore, keratin protein fibers do not assemble properly.

Which mutation(s)may not result in an amino acid change in the protein product?

How many different codons are part of the genetic code?

Most of the energy required to form the peptide bonds during elongation comes from _____.

Ricin inactivates _____.

How much of the human genome actually codes for protein products?

Invitation to Biology

Molecules of Life

Cell Structure

Energy and Metabolism

Capturing and Releasing Energy

Dna Structure and Function

How Cells Reproduce

Patterns of Inheritance

Biotechnology

Evidence of Evolution

Processes of Evolution

Early Life Forms and the Viruses

Plants and Fungi

Animal Evolution

Population Ecology

Communities and Ecosystems

The Biosphere and Human Effects

Animal Tissues and Organs

How Animals Move

Circulation and Respiration

Immunity

Digestion and Excretion

Neural Control and the Senses

Endocrine Control

Reproduction and Development

Plant Form and Function

Plant Reproduction and Development

Filters