Question 1

Transcription factors recognize which of the following?

Accepted Answer

A)  Response elements 
B)  Control elements 
C)  Regulatory elements 
D)  All of the answers are correct 
A)  Response elements 
B)  Control elements 
C)  Regulatory elements 
D)  All of the answers are correct

Question 2

If a portion of a transcription factor's domain is the same in a variety of organisms, it is called a motif.

Accepted Answer

A) True 
 B)False

Question 3

DNA methylation activates gene expression.

Accepted Answer

A) True 
 B)False

Question 4

RNAi is used in eukaryotic cells only to defend against viruses and transposable elements.

Accepted Answer

A) True 
 B)False

Question 5

What would be the result of a mutation in Hsp90?

Accepted Answer

A)  Glucocorticoid receptor could not form a dimmer 
B)  The nuclear localization signal would no longer function 
C)  Expression of the regulated genes would become constitutive 
D)  The hormone would not be able to bind to the glucocorticoid receptor 
A)  Glucocorticoid receptor could not form a dimmer 
B)  The nuclear localization signal would no longer function 
C)  Expression of the regulated genes would become constitutive 
D)  The hormone would not be able to bind to the glucocorticoid receptor

Question 6

Which of the following relationships is true?

Accepted Answer

A)  The more stable an mRNA is, the higher its concentration 
B)  The more unstable an mRNA is, the lower its concentration 
C)  The more unstable an mRNA is, the higher its concentration 
D)  More than one of the answers are correct 
A)  The more stable an mRNA is, the higher its concentration 
B)  The more unstable an mRNA is, the lower its concentration 
C)  The more unstable an mRNA is, the higher its concentration 
D)  More than one of the answers are correct

Question 7

The stability of mRNA is due mostly to which of the following?

Accepted Answer

A)  GC content of the message 
B)  Poly-A binding protein 
C)  Methylation 
D)  5' capping 
E)  Alternative splicing 
A)  GC content of the message 
B)  Poly-A binding protein 
C)  Methylation 
D)  5' capping 
E)  Alternative splicing

Question 8

Transcription factors are proteins that influence the ability of the RNA polymerase to transcribe a
gene.

Accepted Answer

A) True 
 B)False

Question 9

Which is not an example of RNA processing regulation?

Accepted Answer

A)  RNA concentration 
B)  RNA editing 
C)  Alternative splicing 
D)  eIF2a protein kinases 
A)  RNA concentration 
B)  RNA editing 
C)  Alternative splicing 
D)  eIF2a protein kinases

Question 10

Housekeeping genes are unmethylated and active in most cells.

Accepted Answer

A) True 
 B)False

Question 11

Which one of the following directly interacts with the DNA as a transcriptional regulator?

Accepted Answer

A)  cAMP 
B)  G protein 
C)  Protein kinase A 
D)  CREB protein dimmer 
E)  None of the answers are correct 
A)  cAMP 
B)  G protein 
C)  Protein kinase A 
D)  CREB protein dimmer 
E)  None of the answers are correct

Question 12

A person with a mutation in IRP that prevents it from binding iron. What effect will this have?

Accepted Answer

A)  Ferritin will not be made, so iron intake must be maximized 
B)  There will be excess ferritin, so iron intake must be lowered 
C)  Transferrin will not be made, so iron intake must be maximized 
D)  There will be excess transferrin, so iron intake must be lowered 
A)  Ferritin will not be made, so iron intake must be maximized 
B)  There will be excess ferritin, so iron intake must be lowered 
C)  Transferrin will not be made, so iron intake must be maximized 
D)  There will be excess transferrin, so iron intake must be lowered

Question 13

Regulatory transcription factors may be regulated by .

Accepted Answer

A)  Covalent modifications 
B)  Protein-protein interactions 
C)  Use of effector molecules 
D)  All of the answers are correct 
A)  Covalent modifications 
B)  Protein-protein interactions 
C)  Use of effector molecules 
D)  All of the answers are correct

Question 14

What is an example of RNA editing?

Accepted Answer

A)  Changing a valine codon to a stop codon 
B)  Methylation of cytosine bases 
C)  Formation of RISC 
D)  Alternative splicing 
A)  Changing a valine codon to a stop codon 
B)  Methylation of cytosine bases 
C)  Formation of RISC 
D)  Alternative splicing

Question 15

S1 nuclease will cleave which of the following?

Accepted Answer

A)  Double-stranded DNA 
B)  Single-stranded DNA 
C)  A single-stranded probe hybridized to a particular gene 
D)  Chromosomal DNA in an open conformation 
A)  Double-stranded DNA 
B)  Single-stranded DNA 
C)  A single-stranded probe hybridized to a particular gene 
D)  Chromosomal DNA in an open conformation

Question 16

Which of the following mRNAs would be found at the lowest concentration?

Accepted Answer

A)  5' GGAUGGCCGUUUGAAAAAAAAAAAAAAAAAAAAA 3' 
B)  5' GGAUGGCGACCUGAAUUUAAUUUAAUUUAAAAAA 3' 
C)  5' GGAUGGAAGUUUGAAUUUAAUUUAAAAAAAAAAA 3' 
D)  5' GGAUGGGGACUUGAAUUAAAAAAAAAAAAAAAAA 3' 
A)  5' GGAUGGCCGUUUGAAAAAAAAAAAAAAAAAAAAA 3' 
B)  5' GGAUGGCGACCUGAAUUUAAUUUAAUUUAAAAAA 3' 
C)  5' GGAUGGAAGUUUGAAUUUAAUUUAAAAAAAAAAA 3' 
D)  5' GGAUGGGGACUUGAAUUAAAAAAAAAAAAAAAAA 3'

Question 17

Where is the IRE located in the ferritin gene?

Accepted Answer

A)  5' end of DNA 
B)  5' end of mRNA 
C)  3' end of DNA 
D)  3' end of mRNA 
A)  5' end of DNA 
B)  5' end of mRNA 
C)  3' end of DNA 
D)  3' end of mRNA

Question 18

CpG islands are associated with which of the following?

Accepted Answer

A)  Nucleosome location 
B)  DNA methylation 
C)  Steroid hormone activity 
D)  cAMP pathway 
A)  Nucleosome location 
B)  DNA methylation 
C)  Steroid hormone activity 
D)  cAMP pathway

Question 19

Regulatory transcription factors may influence gene expression in which of the following ways?

Accepted Answer

A)  Recruiting proteins to the promoter that enhance chromatin compaction 
B)  By effecting the ability of TFIID to bind to the core promoter 
C)  Influencing the ability of the RNA polymerase to form an initiation complex 
D)  All of the answers are correct 
A)  Recruiting proteins to the promoter that enhance chromatin compaction 
B)  By effecting the ability of TFIID to bind to the core promoter 
C)  Influencing the ability of the RNA polymerase to form an initiation complex 
D)  All of the answers are correct

Question 20

Which of the following would also work as an enhancer for the following bi-directional enhancer? 5' GTTC 3' 3' CAAG 5'

Accepted Answer

A)  5' GAAC 3' 3' CTTG 5' 
B)  5' CTTG 3' 3' GAAC 5' 
C)  5' CAAG 3' 3' GTTC 5' 
D)  More than one of the answers are correct 
A)  5' GAAC 3' 3' CTTG 5' 
B)  5' CTTG 3' 3' GAAC 5' 
C)  5' CAAG 3' 3' GTTC 5' 
D)  More than one of the answers are correct

Exam 15: Gene Regulation in Eukaryotes

Transcription factors recognize which of the following?

If a portion of a transcription factor's domain is the same in a variety of organisms, it is called a motif.

DNA methylation activates gene expression.

RNAi is used in eukaryotic cells only to defend against viruses and transposable elements.

What would be the result of a mutation in Hsp90?

Which of the following relationships is true?

The stability of mRNA is due mostly to which of the following?

Transcription factors are proteins that influence the ability of the RNA polymerase to transcribe a gene.

Which is not an example of RNA processing regulation?

Housekeeping genes are unmethylated and active in most cells.

Which one of the following directly interacts with the DNA as a transcriptional regulator?

A person with a mutation in IRP that prevents it from binding iron. What effect will this have?

Regulatory transcription factors may be regulated by .

What is an example of RNA editing?

S1 nuclease will cleave which of the following?

Which of the following mRNAs would be found at the lowest concentration?

Where is the IRE located in the ferritin gene?

CpG islands are associated with which of the following?

Regulatory transcription factors may influence gene expression in which of the following ways?

Which of the following would also work as an enhancer for the following bi-directional enhancer? 5' GTTC 3' 3' CAAG 5'

Overview of Genetics

Mendelian Inheritance

Reproduction and Chromosome Transmission

Extensions of Mendelian Inheritance

Non-Mendelian Inheritance

Genetic Linkage and Mapping in Eukaryotes

Genetic Transfer and Mapping in Bacteria and

Variation in Chromosome Structure and Number

Molecular Structure of Dna and Rna

Chromosome Organization and Molecular Structure

Dna Replication

Gene Transcription and Rna Modification

Translation of Mrna

Gene Regulation in Bacteria and Bacteriophages

Gene Mutation and Dna Repair

Recombination and Transposition at the Molecular

Recombinant Dna Technology

Biotechnology

Genomics I: Analysis of Dna

Genomics II: Functional Genomics, Proteomics, and

Medical Genetics and Cancer

Developmental Genetics

Population Genetics

Quantitative Genetics

Evolutionary Genetics

Filters