Question 1

Two-dimensional gel electrophoresis separates proteins based on _______ and _______.

Accepted Answer

A)  size;concentration 
B)  size;shape 
C)  size;charge 
D)  concentration;shape 
E)  shape;charge 
A)  size;concentration 
B)  size;shape 
C)  size;charge 
D)  concentration;shape 
E)  shape;charge

Question 2

Which genome is most likely that of a free-living prokaryote?

Accepted Answer

A)  A genome that is 300 million bp long with over 50 percent repetitive DNA and many introns 
B)  A genome that is 16,000 bp long and arranged in a circle 
C)  A genome that is 3 million bp long,arranged in a single circular chromosome,and has little repetitive DNA 
D)  A genome that is 3 million bp long,is arranged in many linear chromosomes,and has many introns 
E)  A genome that is a billion bp long,is arranged in many linear chromosomes,and has many introns 
A)  A genome that is 300 million bp long with over 50 percent repetitive DNA and many introns 
B)  A genome that is 16,000 bp long and arranged in a circle 
C)  A genome that is 3 million bp long,arranged in a single circular chromosome,and has little repetitive DNA 
D)  A genome that is 3 million bp long,is arranged in many linear chromosomes,and has many introns 
E)  A genome that is a billion bp long,is arranged in many linear chromosomes,and has many introns

Question 3

Studies of the relative efficacy or nonefficacy of a drug based on specific genotypes would be considered part of the field of

Accepted Answer

A)  metagenomics. 
B)  metabolomics. 
C)  proteomics. 
D)  pharmacogenomics 
E)  comparative genomics. 
A)  metagenomics. 
B)  metabolomics. 
C)  proteomics. 
D)  pharmacogenomics 
E)  comparative genomics.

Question 4

A DNA sequence has been cut into the four overlapping sequence fragments below: (1)AGGGGCCTATAGCATACGTACA
(2)CGTACATCTGAGGGTACGATCATGGC
(3)CATGGCTAGCAAACGCGATCCCAAG
(4)AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?

Accepted Answer

A)  1;2;3;4 
B)  1;3;2;4 
C)  2;3;1;4 
D)  4;1;2;3 
E)  4;1;3;2 
A)  1;2;3;4 
B)  1;3;2;4 
C)  2;3;1;4 
D)  4;1;2;3 
E)  4;1;3;2

Question 5

Craig Venter,a leader of one of the teams that sequenced the human genome,has now turned his attention to cataloging the microbial life of the oceans.His studies,which involve PCR amplification of microbial DNA and a sequencing of the PCR products,are part of a field of biology called

Accepted Answer

A)  functional genomics. 
B)  transposon tagging. 
C)  proteomics. 
D)  phenomics. 
E)  metagenomics. 
A)  functional genomics. 
B)  transposon tagging. 
C)  proteomics. 
D)  phenomics. 
E)  metagenomics.

Question 6

Which statement about the human genome is true?

Accepted Answer

A)  In any given specialized cell type,most of the genome is being transcribed. 
B)  Most transcripts are cell-type specific. 
C)  Most transposons are active most of the time. 
D)  Noncoding RNAs seldom,if ever,perform regulatory roles. 
E)  Both a and b 
A)  In any given specialized cell type,most of the genome is being transcribed. 
B)  Most transcripts are cell-type specific. 
C)  Most transposons are active most of the time. 
D)  Noncoding RNAs seldom,if ever,perform regulatory roles. 
E)  Both a and b

Question 7

Which DNA sequence would be the most difficult to assemble?

Accepted Answer

A)  A sequence with an ORF 
B)  A sequence consisting of several short repeated fragments 
C)  A sequence with roughly equal proportions of As,Cs,Gs,and Ts 
D)  A sequence with a promoter 
E)  A sequence that contains the fragment CAGCTATT 
A)  A sequence with an ORF 
B)  A sequence consisting of several short repeated fragments 
C)  A sequence with roughly equal proportions of As,Cs,Gs,and Ts 
D)  A sequence with a promoter 
E)  A sequence that contains the fragment CAGCTATT

Question 8

Which statement about the globin genes in humans is false?

Accepted Answer

A)  They are all expressed at the same time. 
B)  They all arose from a single common ancestor gene. 
C)  They are an example of a gene family. 
D)  Some of the different genes carry out different functions. 
E)  All of the above are true;none is false. 
A)  They are all expressed at the same time. 
B)  They all arose from a single common ancestor gene. 
C)  They are an example of a gene family. 
D)  Some of the different genes carry out different functions. 
E)  All of the above are true;none is false.

Question 9

Haplotype maps are based primarily on

Accepted Answer

A)  the positions of transposons. 
B)  variations at specific nucleotides. 
C)  whether or not open reading frames exist. 
D)  the extent to which a gene is expressed. 
E)  where on the chromosome the gene is located. 
A)  the positions of transposons. 
B)  variations at specific nucleotides. 
C)  whether or not open reading frames exist. 
D)  the extent to which a gene is expressed. 
E)  where on the chromosome the gene is located.

Question 10

Rank the following in terms of their relationship to the phenotypic characteristics of a cell or organism (from closest to most distant): the genome,the proteome,and the metabolome.

Accepted Answer

A)  Genome;proteome;metabolome 
B)  Genome;metabolome;proteome 
C)  Proteome;metabolome;genome 
D)  Proteome;genome;metabolome 
E)  Metabolome;proteome;genome 
A)  Genome;proteome;metabolome 
B)  Genome;metabolome;proteome 
C)  Proteome;metabolome;genome 
D)  Proteome;genome;metabolome 
E)  Metabolome;proteome;genome

Question 11

Which of the following is a major difference between LINEs and SINEs?

Accepted Answer

A)  Proteins sometimes are translated from LINEs but they never are from SINEs. 
B)  SINEs make RNA copies of themselves,whereas LINEs do not. 
C)  LINEs make RNA copies of themselves,whereas SINEs do not. 
D)  SINEs are larger than LINEs. 
E)  SINEs can move from place to place in the genome,whereas LINEs cannot. 
A)  Proteins sometimes are translated from LINEs but they never are from SINEs. 
B)  SINEs make RNA copies of themselves,whereas LINEs do not. 
C)  LINEs make RNA copies of themselves,whereas SINEs do not. 
D)  SINEs are larger than LINEs. 
E)  SINEs can move from place to place in the genome,whereas LINEs cannot.

Question 12

Which statement about eukaryotic genomes as compared with prokaryotic genomes is false?

Accepted Answer

A)  They tend to be larger. 
B)  They tend to have more regulatory sequences. 
C)  The percentage of the genome devoted to coding sequence is higher. 
D)  They usually have more repetitive DNA. 
E)  They usually have more protein-coding genes. 
A)  They tend to be larger. 
B)  They tend to have more regulatory sequences. 
C)  The percentage of the genome devoted to coding sequence is higher. 
D)  They usually have more repetitive DNA. 
E)  They usually have more protein-coding genes.

Question 13

Which statement would be considered an expression of genetic determinism?

Accepted Answer

A)  The proteome is more complex than the genome. 
B)  All people who are homozygous for the sickle-cell allele have sickle-cell disease. 
C)  Studying genes provides a limited understanding of what is going on in the cell. 
D)  The metabolome exerts considerable influence on the likelihood that an individual will develop diabetes. 
E)  High levels of glucose may be an indicator of coronary heart disease. 
A)  The proteome is more complex than the genome. 
B)  All people who are homozygous for the sickle-cell allele have sickle-cell disease. 
C)  Studying genes provides a limited understanding of what is going on in the cell. 
D)  The metabolome exerts considerable influence on the likelihood that an individual will develop diabetes. 
E)  High levels of glucose may be an indicator of coronary heart disease.

Question 14

The gene most responsible for differences in size among different breeds of dogs is the _______ gene.

Accepted Answer

A)  myostatin 
B)  phosphofructokinase 
C)  insulin-like growth factor 
D)  tyrosine growth factor 
E)  giant 
A)  myostatin 
B)  phosphofructokinase 
C)  insulin-like growth factor 
D)  tyrosine growth factor 
E)  giant

Question 15

A study comparing the proteins that are produced in sperm cells to those of skin cells is an example of

Accepted Answer

A)  comparative genomics. 
B)  functional genomics. 
C)  pharmacogenomics. 
D)  metabolomics. 
E)  proteomics. 
A)  comparative genomics. 
B)  functional genomics. 
C)  pharmacogenomics. 
D)  metabolomics. 
E)  proteomics.

Question 16

Use the following to answer questions :
The hypothetical anti-anxiety drug Epitome is inactive when taken,but it is activated by the rasputin enzyme a few hours after injection.Alleles 1 and 2 of the gene that encodes rasputin have similar activity levels.Individuals with one or both copies of allele 3,which is very rare,have much higher levels of enzyme activity.Individuals who have both copies of allele 4 have much lower levels of enzyme activity.Heterozygotes of allele 4 have normal levels of enzyme activity.
-The Epitome drug would be most likely to be ineffective in individuals whose genotype has one copy of allele _______ and one copy of allele _______.

Accepted Answer

A)  4;4 
B)  2;4 
C)  2;3 
D)  2;2 
E)  1;4 
A)  4;4 
B)  2;4 
C)  2;3 
D)  2;2 
E)  1;4

Question 17

DNA fingerprinting most often is based on

Accepted Answer

A)  SNPs. 
B)  open reading frames. 
C)  telomeres. 
D)  repetitive DNA. 
E)  transposons. 
A)  SNPs. 
B)  open reading frames. 
C)  telomeres. 
D)  repetitive DNA. 
E)  transposons.

Question 18

The closest living relatives to humans are _______,followed next by _______.

Accepted Answer

A)  chimpanzees;gorillas 
B)  chimpanzees;gibbons 
C)  gorillas;orangutans 
D)  gorillas;chimpanzees 
E)  orangutans;chimpanzees 
A)  chimpanzees;gorillas 
B)  chimpanzees;gibbons 
C)  gorillas;orangutans 
D)  gorillas;chimpanzees 
E)  orangutans;chimpanzees

Question 19

If the universal adapter sequence is GTCATTGCTTGCAATGTT,which universal primer should be used for DNA sequencing?

Accepted Answer

A)  GTCATTGCTTGCAATGTT 
B)  TTGTAACGTTCGTTACTG 
C)  CAGTAACGAACGTTACAA 
D)  CCTGAATTGGTCGTACAA 
E)  GUCAUUGCUUGCAAUGUU 
A)  GTCATTGCTTGCAATGTT 
B)  TTGTAACGTTCGTTACTG 
C)  CAGTAACGAACGTTACAA 
D)  CCTGAATTGGTCGTACAA 
E)  GUCAUUGCUUGCAAUGUU

Question 20

Approximately how many Mycoplasma genitalium genomes would be equivalent to the haploid human genome (in terms of base pairs)?

Accepted Answer

A)  55 
B)  250 
C)  550 
D)  5,500 
E)  25,000 
A)  55 
B)  250 
C)  550 
D)  5,500 
E)  25,000

Exam 12: Genomes

Two-dimensional gel electrophoresis separates proteins based on _______ and _______.

Which genome is most likely that of a free-living prokaryote?

Studies of the relative efficacy or nonefficacy of a drug based on specific genotypes would be considered part of the field of

A DNA sequence has been cut into the four overlapping sequence fragments below: (1)AGGGGCCTATAGCATACGTACA (2)CGTACATCTGAGGGTACGATCATGGC (3)CATGGCTAGCAAACGCGATCCCAAG (4)AGGCTAGTTACGATATAGGGGCC What is the correct order of these fragments?

Craig Venter,a leader of one of the teams that sequenced the human genome,has now turned his attention to cataloging the microbial life of the oceans.His studies,which involve PCR amplification of microbial DNA and a sequencing of the PCR products,are part of a field of biology called

Which statement about the human genome is true?

Which DNA sequence would be the most difficult to assemble?

Which statement about the globin genes in humans is false?

Haplotype maps are based primarily on

Rank the following in terms of their relationship to the phenotypic characteristics of a cell or organism (from closest to most distant): the genome,the proteome,and the metabolome.

Which of the following is a major difference between LINEs and SINEs?

Which statement about eukaryotic genomes as compared with prokaryotic genomes is false?

Which statement would be considered an expression of genetic determinism?

The gene most responsible for differences in size among different breeds of dogs is the _______ gene.

A study comparing the proteins that are produced in sperm cells to those of skin cells is an example of

DNA fingerprinting most often is based on

The closest living relatives to humans are _______,followed next by _______.

If the universal adapter sequence is GTCATTGCTTGCAATGTT,which universal primer should be used for DNA sequencing?

Approximately how many Mycoplasma genitalium genomes would be equivalent to the haploid human genome (in terms of base pairs)?

Introduction

The Chemistry and Energy of Life

Nucleic Acids, Proteins, and Enzymes

Cells: the Working Units of Life

Cell Membranes and Signaling

Pathways That Harvest and Store Chemical Energy

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

DNA and Its Role in Heredity

From Dna to Protein: Gene Expression

Regulation of Gene Expression

Biotechnology

Genes, Development, and Evolution

Processes of Evolution

Reconstructing and Using Phylogenies

Speciation

The History of Life on Earth

Bacteria, Archaea, and Viruses

The Origin and Diversification of Eukaryotes

The Evolution of Plants

The Evolution and Diversity of Fungi

Animal Origins and Diversity

The Plant Body

Plant Nutrition and Transport

Plant Growth and Development

Reproduction of Flowering Plants

Plants in the Environment

Fundamentals of Animal Function

Nutrition and Digestion

Breathing

Circulation

Muscle and Movement

Neurons, Sense Organs, and Nervous Systems

Nervous and Endocrine Control

Water and Salts: Excretion

Animal Reproduction

Animal Development

Immunology: Animal Defense Systems

Animal Behavior

The Distribution of Earths Ecological Systems

Populations

Ecological and Evolutionary Consequences of Interactions Within and Among Species

Ecological Communities

The Global Ecosystem

Filters

Two-dimensional gel electrophoresis separates proteins based on _ and _.

The closest living relatives to humans are _,followed next by _.