Solved

A DNA Sequence Has Been Cut into the Four Overlapping

Question 24

Multiple Choice

A DNA sequence has been cut into the four overlapping sequence fragments below: (1) AGGGGCCTATAGCATACGTACA
(2) CGTACATCTGAGGGTACGATCATGGC
(3) CATGGCTAGCAAACGCGATCCCAAG
(4) AGGCTAGTTACGATATAGGGGCC
What is the correct order of these fragments?


A) 1;2;3;4
B) 1;3;2;4
C) 2;3;1;4
D) 4;1;2;3
E) 4;1;3;2

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q19: Which statement about pseudogenes is true?<br>A) There

Q20: The first free-living organism to have its

Q22: Which genome is most likely that of

Q23: Studies of the relative efficacy or nonefficacy

Q26: Which statement about the human genome is

Q27: Which DNA sequence would be the most

Q28: Which statement about the globin genes in

Q29: Haplotype maps are based primarily on<br>A) the

Q38: Two-dimensional gel electrophoresis separates proteins based on

Q131: Craig Venter, a leader of one of