Question 1

A biologist sequencing the DNA of various species of pathogenic bacteria with the goal of determining their evolutionary relationships is practicing _______ genomics.

Accepted Answer

A)  functional 
B)  operational 
C)  meta- 
D)  comparative 
E)  eukaryotic 
A)  functional 
B)  operational 
C)  meta- 
D)  comparative 
E)  eukaryotic

Question 2

In high-throughput DNA sequencing technology,the PCR technique

Accepted Answer

A)  breaks the DNA into small fragments. 
B)  produces many identical copies of specific DNA fragments. 
C)  labels each of the four nucleotides with a different marker. 
D)  enables overlapping sequences to be assembled into one complete sequence. 
E)  chemically modifies each nucleotide. 
A)  breaks the DNA into small fragments. 
B)  produces many identical copies of specific DNA fragments. 
C)  labels each of the four nucleotides with a different marker. 
D)  enables overlapping sequences to be assembled into one complete sequence. 
E)  chemically modifies each nucleotide.

Question 3

The Human Genome Project could not have proceeded without the new field of _______,which uses complex mathematics and computer programs to analyze DNA sequences.

Accepted Answer

The answer of The Human Genome Project could not have...

Question 4

Which statement about personal genomics is false?

Accepted Answer

A)  The utility of genomic scans for determining whether a person will acquire coronary heart disease is limited because of the phenomenon of genetic determinism. 
B)  Microarrays are frequently used in studies that examine which specific SNPs are associated with diseases. 
C)  Association tests have revealed haplotypes that are associated with modest increases of risk for acquiring various diseases. 
D)  The vast number of SNPs mapped and the large number of people sampled necessitate rigorous statistical methodology in association tests. 
E)  All of the above are true;none is false. 
A)  The utility of genomic scans for determining whether a person will acquire coronary heart disease is limited because of the phenomenon of genetic determinism. 
B)  Microarrays are frequently used in studies that examine which specific SNPs are associated with diseases. 
C)  Association tests have revealed haplotypes that are associated with modest increases of risk for acquiring various diseases. 
D)  The vast number of SNPs mapped and the large number of people sampled necessitate rigorous statistical methodology in association tests. 
E)  All of the above are true;none is false.

Question 5

In which species or population would haplotype mapping be particularly challenging or practically impossible?

Accepted Answer

A)  A salamander species that has a particularly large genome size 
B)  Dogs,because of the large number of breeds 
C)  Pufferfish,which have a relatively small genome size (for a vertebrate) 
D)  Cheetahs,because they have extraordinarily low amounts of genetic diversity 
E)  A species of ant that has a large number of chromosomes 
A)  A salamander species that has a particularly large genome size 
B)  Dogs,because of the large number of breeds 
C)  Pufferfish,which have a relatively small genome size (for a vertebrate) 
D)  Cheetahs,because they have extraordinarily low amounts of genetic diversity 
E)  A species of ant that has a large number of chromosomes

Question 6

High-throughput sequencing relies on _______ to amplify the number of identical sequence fragments.

Accepted Answer

The answer of High-throughput sequencing relies on _______ to amplify...

Question 7

Which of the following is not a main type of transposon in the human genome?

Accepted Answer

A)  SINEs 
B)  LINEs 
C)  DNA transposons 
D)  Retrotransposons 
E)  All of the above are main types of transposon in the human genome. 
A)  SINEs 
B)  LINEs 
C)  DNA transposons 
D)  Retrotransposons 
E)  All of the above are main types of transposon in the human genome.

Question 8

Which process or element is required for the formation of gene families?

Accepted Answer

A)  Highly repetitive DNA 
B)  Pseudogenes 
C)  Transposable elements 
D)  Gene inactivation 
E)  Gene duplication 
A)  Highly repetitive DNA 
B)  Pseudogenes 
C)  Transposable elements 
D)  Gene inactivation 
E)  Gene duplication

Question 9

In high-throughput DNA sequencing,the universal adapter sequence is _______ to the universal _______ sequence.

Accepted Answer

A)  identical;primer 
B)  identical;polymerase 
C)  identical;template 
D)  complementary;primer 
E)  complementary;polymerase 
A)  identical;primer 
B)  identical;polymerase 
C)  identical;template 
D)  complementary;primer 
E)  complementary;polymerase

Question 10

In some species of moths,the genes that make chorion for the eggshell are found in multiple copies in order to maximize the production of chorion at specific times.In this regard,these chorion genes are most like

Accepted Answer

A)  pseudogenes. 
B)  highly repetitive DNA. 
C)  rRNA genes. 
D)  transposons. 
E)  open reading frames. 
A)  pseudogenes. 
B)  highly repetitive DNA. 
C)  rRNA genes. 
D)  transposons. 
E)  open reading frames.

Question 11

Which statement about metabolomics is true?

Accepted Answer

A)  Medical researchers are well ahead of plant biologists in metabolomics research. 
B)  It often uses gas chromatography. 
C)  It is concerned only with the proteins found in cells. 
D)  It is concerned only with the carbohydrates found in cells. 
E)  An individual's metabolic profile will look the same regardless of what cell type is examined. 
A)  Medical researchers are well ahead of plant biologists in metabolomics research. 
B)  It often uses gas chromatography. 
C)  It is concerned only with the proteins found in cells. 
D)  It is concerned only with the carbohydrates found in cells. 
E)  An individual's metabolic profile will look the same regardless of what cell type is examined.

Question 12

Different functional units of a protein are called

Accepted Answer

A)  open reading frames. 
B)  domains. 
C)  haplotypes. 
D)  proteomes. 
E)  SNPs. 
A)  open reading frames. 
B)  domains. 
C)  haplotypes. 
D)  proteomes. 
E)  SNPs.

Question 13

If a plant were to acquire mobility,such that it could more easily escape adverse conditions and enemies,genes involved in which function would most likely be lost over evolutionary time? (Hint: Think about the comparative genomics of plants and animals,such as those of Arabidopsis and the nematode C.elegans. )

Accepted Answer

A)  Photosynthesis 
B)  Cell signaling 
C)  Defense chemicals 
D)  Cell growth 
E)  Metabolism 
A)  Photosynthesis 
B)  Cell signaling 
C)  Defense chemicals 
D)  Cell growth 
E)  Metabolism

Question 14

Which field or approach is most likely to lead directly to a reduction in the negative side effects associated with a drug used to treat diabetes?

Accepted Answer

A)  Comparative genomics 
B)  Metagenomics 
C)  Metabolomics 
D)  Pharmacogenomics 
E)  Selective inactivation 
A)  Comparative genomics 
B)  Metagenomics 
C)  Metabolomics 
D)  Pharmacogenomics 
E)  Selective inactivation

Question 15

The fly D.melanogaster is generally thought to be _______ complex than the nematode C.elegans because the fly _______.

Accepted Answer

A)  more;has to produce many more metabolites for defense 
B)  more;undergoes more complex developmental transformations 
C)  more;has membrane-enclosed organelles 
D)  less;lacks membrane-enclosed organelles 
E)  less;undergoes less complex developmental transformations 
A)  more;has to produce many more metabolites for defense 
B)  more;undergoes more complex developmental transformations 
C)  more;has membrane-enclosed organelles 
D)  less;lacks membrane-enclosed organelles 
E)  less;undergoes less complex developmental transformations

Question 16

Which development is most likely to come about via metagenomic studies?

Accepted Answer

A)  Discoveries about the functions of new genes 
B)  The determination of the minimal genome size necessary for a free-living organism 
C)  Explorations of a marine ecosystem 
D)  Determinations of how quickly a particular gene evolves 
E)  Indications of which medicine to use with a particular patient 
A)  Discoveries about the functions of new genes 
B)  The determination of the minimal genome size necessary for a free-living organism 
C)  Explorations of a marine ecosystem 
D)  Determinations of how quickly a particular gene evolves 
E)  Indications of which medicine to use with a particular patient

Question 17

A DNA sequence has been cut into the three overlapping sequence fragments below: (1)CCGCGCGTAGCGAGTCAG
(2)GGCTAGTTAGCTCCGCGCG
(3)AGTCAGTCAAAAT
What is the correct assembled sequence of these fragments?

Accepted Answer

A)  GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT 
B)  CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT 
C)  CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG 
D)  AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC 
E)  AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA 
A)  GGCTAGTTAGCTCCGCGCGTAGCGAGTCAGTCAAAAT 
B)  CCGCGCGTAGCGTTAGCTCCGCGCGCAAAGTCAAAAT 
C)  CCGCGCGTAGCGAGTCAGGGCTAGTTAGCTCCGCGCG 
D)  AGTCAGTCAAAATGGCTAGTTAGCTCCGCGCGCCGCGC 
E)  AGTGATACTAAGATGATGAAGTGATCCACATATAGCGA

Question 18

Which statement comparing the genome of humans to that of invertebrates like C.elegans and D.melanogaster is true?

Accepted Answer

A)  A larger fraction of DNA in the human genome is for coding proteins. 
B)  The human genome has more than ten times the number of protein-coding genes. 
C)  The average human gene codes for more proteins. 
D)  The human genome has many fewer transposons. 
E)  There are fewer introns in human genes. 
A)  A larger fraction of DNA in the human genome is for coding proteins. 
B)  The human genome has more than ten times the number of protein-coding genes. 
C)  The average human gene codes for more proteins. 
D)  The human genome has many fewer transposons. 
E)  There are fewer introns in human genes.

Question 19

Which method or technique would likely provide the most information about the genome?

Accepted Answer

A)  SNP genotyping 
B)  Genome sequencing 
C)  STR genotyping 
D)  Haplotype mapping 
E)  Genome inactivation 
A)  SNP genotyping 
B)  Genome sequencing 
C)  STR genotyping 
D)  Haplotype mapping 
E)  Genome inactivation

Question 20

Which technique or activity is least likely to be associated with metagenomics?

Accepted Answer

A)  Bacterial culture techniques 
B)  DNA sequencing 
C)  Comparative genomics 
D)  PCR 
E)  Sampling from the field 
A)  Bacterial culture techniques 
B)  DNA sequencing 
C)  Comparative genomics 
D)  PCR 
E)  Sampling from the field

Exam 12: Genomes

A biologist sequencing the DNA of various species of pathogenic bacteria with the goal of determining their evolutionary relationships is practicing _______ genomics.

In high-throughput DNA sequencing technology,the PCR technique

The Human Genome Project could not have proceeded without the new field of _______,which uses complex mathematics and computer programs to analyze DNA sequences.

Which statement about personal genomics is false?

In which species or population would haplotype mapping be particularly challenging or practically impossible?

High-throughput sequencing relies on _______ to amplify the number of identical sequence fragments.

Which of the following is not a main type of transposon in the human genome?

Which process or element is required for the formation of gene families?

In high-throughput DNA sequencing,the universal adapter sequence is _______ to the universal _______ sequence.

In some species of moths,the genes that make chorion for the eggshell are found in multiple copies in order to maximize the production of chorion at specific times.In this regard,these chorion genes are most like

Which statement about metabolomics is true?

Different functional units of a protein are called

Which field or approach is most likely to lead directly to a reduction in the negative side effects associated with a drug used to treat diabetes?

The fly D.melanogaster is generally thought to be _______ complex than the nematode C.elegans because the fly _______.

Which development is most likely to come about via metagenomic studies?

A DNA sequence has been cut into the three overlapping sequence fragments below: (1)CCGCGCGTAGCGAGTCAG (2)GGCTAGTTAGCTCCGCGCG (3)AGTCAGTCAAAAT What is the correct assembled sequence of these fragments?

Which statement comparing the genome of humans to that of invertebrates like C.elegans and D.melanogaster is true?

Which method or technique would likely provide the most information about the genome?

Which technique or activity is least likely to be associated with metagenomics?

Introduction

The Chemistry and Energy of Life

Nucleic Acids, Proteins, and Enzymes

Cells: the Working Units of Life

Cell Membranes and Signaling

Pathways That Harvest and Store Chemical Energy

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

DNA and Its Role in Heredity

From Dna to Protein: Gene Expression

Regulation of Gene Expression

Biotechnology

Genes, Development, and Evolution

Processes of Evolution

Reconstructing and Using Phylogenies

Speciation

The History of Life on Earth

Bacteria, Archaea, and Viruses

The Origin and Diversification of Eukaryotes

The Evolution of Plants

The Evolution and Diversity of Fungi

Animal Origins and Diversity

The Plant Body

Plant Nutrition and Transport

Plant Growth and Development

Reproduction of Flowering Plants

Plants in the Environment

Fundamentals of Animal Function

Nutrition and Digestion

Breathing

Circulation

Muscle and Movement

Neurons, Sense Organs, and Nervous Systems

Nervous and Endocrine Control

Water and Salts: Excretion

Animal Reproduction

Animal Development

Immunology: Animal Defense Systems

Animal Behavior

The Distribution of Earths Ecological Systems

Populations

Ecological and Evolutionary Consequences of Interactions Within and Among Species

Ecological Communities

The Global Ecosystem

Filters

In high-throughput DNA sequencing,the universal adapter sequence is _ to the universal _ sequence.

The fly D.melanogaster is generally thought to be _ complex than the nematode C.elegans because the fly _.