Question 1

A promoter is an example of a(n)

Accepted Answer

A)  open reading frame. 
B)  transposable element. 
C)  chromatin sequence. 
D)  rRNA gene. 
E)  regulatory sequence. 
A)  open reading frame. 
B)  transposable element. 
C)  chromatin sequence. 
D)  rRNA gene. 
E)  regulatory sequence.

Question 2

Which organism would most likely have a proteome that is much larger than the genome?

Accepted Answer

A)  One with a great deal of highly repetitive DNA 
B)  One with little highly repetitive DNA 
C)  One with a great deal of alternative splicing 
D)  One with little alternative splicing 
E)  One with a lot of secondary metabolites 
A)  One with a great deal of highly repetitive DNA 
B)  One with little highly repetitive DNA 
C)  One with a great deal of alternative splicing 
D)  One with little alternative splicing 
E)  One with a lot of secondary metabolites

Question 3

In high-throughput DNA sequencing technology,the fluorescent dye

Accepted Answer

A)  breaks the DNA into fragments. 
B)  produces many identical copies of specific DNA fragments. 
C)  labels each of the four nucleotides with a different marker. 
D)  enables overlapping sequences to be assembled into one complete sequence. 
E)  chemically modifies each nucleotide. 
A)  breaks the DNA into fragments. 
B)  produces many identical copies of specific DNA fragments. 
C)  labels each of the four nucleotides with a different marker. 
D)  enables overlapping sequences to be assembled into one complete sequence. 
E)  chemically modifies each nucleotide.

Question 4

Humans have roughly _______ the number of protein-coding genes as D.melanogaster and about _______ the number of genes as S.cerevisae.

Accepted Answer

A)  twice;twice 
B)  twice;four times 
C)  four times;four times 
D)  four times;100 times 
E)  100 times;1,000 times 
A)  twice;twice 
B)  twice;four times 
C)  four times;four times 
D)  four times;100 times 
E)  100 times;1,000 times

Question 5

Which statement about the human proteome is false?

Accepted Answer

A)  It is the sum total of all proteins produced by an organism. 
B)  It is more complex than the genome. 
C)  It includes the small molecules found in a cell. 
D)  Its study often involves the use of two-dimensional gel electrophoresis. 
E)  All of the above are true;none is false. 
A)  It is the sum total of all proteins produced by an organism. 
B)  It is more complex than the genome. 
C)  It includes the small molecules found in a cell. 
D)  Its study often involves the use of two-dimensional gel electrophoresis. 
E)  All of the above are true;none is false.

Question 6

Which statement about the nematode C.elegans is false?

Accepted Answer

A)  It has a transparent body. 
B)  Despite having a small number of cells,it has a nervous system. 
C)  Despite having a small number of cells,it can reproduce sexually. 
D)  It normally lives in soil. 
E)  All of the above are true;none is false. 
A)  It has a transparent body. 
B)  Despite having a small number of cells,it has a nervous system. 
C)  Despite having a small number of cells,it can reproduce sexually. 
D)  It normally lives in soil. 
E)  All of the above are true;none is false.

Question 7

Which statement about the Human Genome Project (HGP)is false?

Accepted Answer

A)  The sequencing of smaller genomes helped in the development of methods that benefited the HGP. 
B)  Only privately funded groups were involved in the sequencing effort. 
C)  The HGP was in part spurred on by a desire to determine the specific DNA damage caused by radiation from the atomic blasts on Japan during World War II. 
D)  One objective of the HGP was to identify genetic changes associated with disease. 
E)  It was completed in the first decade of the twenty-first century. 
A)  The sequencing of smaller genomes helped in the development of methods that benefited the HGP. 
B)  Only privately funded groups were involved in the sequencing effort. 
C)  The HGP was in part spurred on by a desire to determine the specific DNA damage caused by radiation from the atomic blasts on Japan during World War II. 
D)  One objective of the HGP was to identify genetic changes associated with disease. 
E)  It was completed in the first decade of the twenty-first century.

Question 8

You are told that a genome is about 10 Mb long,has 5,000 genes,has introns,and that 65 percent of its sequence is coding sequence.This genome most likely belongs to a(n)

Accepted Answer

A)  virus. 
B)  bacterium. 
C)  yeast. 
D)  multicellular plant. 
E)  multicellular animal. 
A)  virus. 
B)  bacterium. 
C)  yeast. 
D)  multicellular plant. 
E)  multicellular animal.

Question 9

Which statement about DNA fingerprinting is false?

Accepted Answer

A)  Short tandem repeats are the primary genetic unit used in DNA fingerprinting. 
B)  DNA fingerprinting can be applied to analyze historical cases as well as current ones. 
C)  DNA fingerprinting can be used to determine the identity of the father of a given individual. 
D)  PCR is often used in DNA fingerprinting. 
E)  All of the above are true;none is false. 
A)  Short tandem repeats are the primary genetic unit used in DNA fingerprinting. 
B)  DNA fingerprinting can be applied to analyze historical cases as well as current ones. 
C)  DNA fingerprinting can be used to determine the identity of the father of a given individual. 
D)  PCR is often used in DNA fingerprinting. 
E)  All of the above are true;none is false.

Question 10

The minimal genome for a free-living bacterium that can survive in the laboratory is likely to consist of _______ genes.

Accepted Answer

A)  50 or fewer 
B)  about 50 to 100 
C)  about 100 to 500 
D)  about 500 to 2,000 
E)  more than 2,000 
A)  50 or fewer 
B)  about 50 to 100 
C)  about 100 to 500 
D)  about 500 to 2,000 
E)  more than 2,000

Question 11

A biologist who is trying to find open reading frames in a section of DNA is working in the field of

Accepted Answer

A)  functional genomics. 
B)  comparative genomics. 
C)  metagenomics. 
D)  biodiversity. 
E)  proteomics. 
A)  functional genomics. 
B)  comparative genomics. 
C)  metagenomics. 
D)  biodiversity. 
E)  proteomics.

Question 12

Which technique,tool,or activity would be most relevant in identifying the genetic variants associated with a complex human disease like schizophrenia?

Accepted Answer

A)  Determination of the metabolome 
B)  Selective inactivation 
C)  Metagenomics 
D)  Haplotype mapping 
E)  A pseudogene screen 
A)  Determination of the metabolome 
B)  Selective inactivation 
C)  Metagenomics 
D)  Haplotype mapping 
E)  A pseudogene screen

Question 13

Which of the following is an example of a secondary metabolite?

Accepted Answer

A)  Tannins produced by oak trees to ward off herbivores 
B)  The enzyme phosophofructokinase,which has a role in glycolysis 
C)  Hemoglobin carrying oxygen in the blood 
D)  Collagen,a structural protein 
E)  ATP 
A)  Tannins produced by oak trees to ward off herbivores 
B)  The enzyme phosophofructokinase,which has a role in glycolysis 
C)  Hemoglobin carrying oxygen in the blood 
D)  Collagen,a structural protein 
E)  ATP

Question 14

Short tandem repeats

Accepted Answer

A)  usually are inherited from both the mother and the father. 
B)  usually consist of many thousands of repeated units. 
C)  are a form of transposon. 
D)  are a form of DNA microarray. 
E)  consist of open reading frames. 
A)  usually are inherited from both the mother and the father. 
B)  usually consist of many thousands of repeated units. 
C)  are a form of transposon. 
D)  are a form of DNA microarray. 
E)  consist of open reading frames.

Question 15

Which disease is most unlike the others with respect to its genetic basis?

Accepted Answer

A)  Coronary heart disease 
B)  Sickle-cell anemia 
C)  Alzheimer's disease 
D)  Type I diabetes 
E)  Rheumatoid arthritis 
A)  Coronary heart disease 
B)  Sickle-cell anemia 
C)  Alzheimer's disease 
D)  Type I diabetes 
E)  Rheumatoid arthritis

Question 16

Which technique or tool is best suited to determine the minimal genome of a free-living bacterium?

Accepted Answer

A)  Metagenomics 
B)  Haplotype mapping 
C)  Pharmacogenetics 
D)  Bacterial artificial chromosomes 
E)  Selective inactivation of genes 
A)  Metagenomics 
B)  Haplotype mapping 
C)  Pharmacogenetics 
D)  Bacterial artificial chromosomes 
E)  Selective inactivation of genes

Question 17

DNA sequencing resembles the natural process of

Accepted Answer

A)  protein synthesis. 
B)  DNA repair. 
C)  DNA replication. 
D)  reverse transcription. 
E)  alternative splicing. 
A)  protein synthesis. 
B)  DNA repair. 
C)  DNA replication. 
D)  reverse transcription. 
E)  alternative splicing.

Question 18

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3'): CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3'): CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?

Accepted Answer

A)  CGACGTCGTCGCCCGATACGTTATCG 
B)  GTCGTCGCCCGATACGTTATCGCGAC 
C)  CGATACGTTATCGCGACGTCGTCGCC 
D)  CGATACGTCGTCGCCGTTATCGCGAC 
E)  CGAUACGUCGUCGCCGUUAUCGCGAC 
A)  CGACGTCGTCGCCCGATACGTTATCG 
B)  GTCGTCGCCCGATACGTTATCGCGAC 
C)  CGATACGTTATCGCGACGTCGTCGCC 
D)  CGATACGTCGTCGCCGTTATCGCGAC 
E)  CGAUACGUCGUCGCCGUUAUCGCGAC

Exam 12: Genomes

A promoter is an example of a(n)

Which organism would most likely have a proteome that is much larger than the genome?

In high-throughput DNA sequencing technology,the fluorescent dye

Humans have roughly _______ the number of protein-coding genes as D.melanogaster and about _______ the number of genes as S.cerevisae.

Which statement about the human proteome is false?

Which statement about the nematode C.elegans is false?

Which statement about the Human Genome Project (HGP)is false?

You are told that a genome is about 10 Mb long,has 5,000 genes,has introns,and that 65 percent of its sequence is coding sequence.This genome most likely belongs to a(n)

Which statement about DNA fingerprinting is false?

The minimal genome for a free-living bacterium that can survive in the laboratory is likely to consist of _______ genes.

A biologist who is trying to find open reading frames in a section of DNA is working in the field of

Which technique,tool,or activity would be most relevant in identifying the genetic variants associated with a complex human disease like schizophrenia?

Which of the following is an example of a secondary metabolite?

Short tandem repeats

Which disease is most unlike the others with respect to its genetic basis?

Which technique or tool is best suited to determine the minimal genome of a free-living bacterium?

DNA sequencing resembles the natural process of

A DNA sequence is cut by two different methods.The first method yields the following fragments (read 5' to 3'): CGATAC;GTCGTCGCC;GTTATCGCGAC.The second method yields the following fragments (read 5' to 3'): CGACGTCGTCGCC;CGATACGTTATCG.What was the original sequence?

Introduction

The Chemistry and Energy of Life

Nucleic Acids, Proteins, and Enzymes

Cells: the Working Units of Life

Cell Membranes and Signaling

Pathways That Harvest and Store Chemical Energy

The Cell Cycle and Cell Division

Inheritance, Genes, and Chromosomes

DNA and Its Role in Heredity

From Dna to Protein: Gene Expression

Regulation of Gene Expression

Biotechnology

Genes, Development, and Evolution

Processes of Evolution

Reconstructing and Using Phylogenies

Speciation

The History of Life on Earth

Bacteria, Archaea, and Viruses

The Origin and Diversification of Eukaryotes

The Evolution of Plants

The Evolution and Diversity of Fungi

Animal Origins and Diversity

The Plant Body

Plant Nutrition and Transport

Plant Growth and Development

Reproduction of Flowering Plants

Plants in the Environment

Fundamentals of Animal Function

Nutrition and Digestion

Breathing

Circulation

Muscle and Movement

Neurons, Sense Organs, and Nervous Systems

Nervous and Endocrine Control

Water and Salts: Excretion

Animal Reproduction

Animal Development

Immunology: Animal Defense Systems

Animal Behavior

The Distribution of Earths Ecological Systems

Populations

Ecological and Evolutionary Consequences of Interactions Within and Among Species

Ecological Communities

The Global Ecosystem

Filters

Humans have roughly _ the number of protein-coding genes as D.melanogaster and about _ the number of genes as S.cerevisae.