Question 1

Which of the following is a genetically modified organism?

Accepted Answer

A) an organism carrying a gene that was acquired by artificial means 
B) the first organism in which a particular mutation has appeared 
C) a cloned organism carrying two different alleles 
D) an organism that gestated in an artificial womb 
A) an organism carrying a gene that was acquired by artificial means 
B) the first organism in which a particular mutation has appeared 
C) a cloned organism carrying two different alleles 
D) an organism that gestated in an artificial womb

Question 2

The scientific field that studies complete sets of genes is called ________.

Accepted Answer

A) genomics 
B) metagenomics 
C) proteomics 
D) genetic engineering 
A) genomics 
B) metagenomics 
C) proteomics 
D) genetic engineering

Question 3

When plasmids are used to produce a desired protein,the ________.

Accepted Answer

A) plasmids multiply and produce the protein outside of the bacterium 
B) bacterial chromosome is genetically engineered,and the plasmid is used to help the bacterium replicate 
C) desired gene is inserted into the plasmid,and the plasmid is taken up by the bacterium 
D) bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene 
A) plasmids multiply and produce the protein outside of the bacterium 
B) bacterial chromosome is genetically engineered,and the plasmid is used to help the bacterium replicate 
C) desired gene is inserted into the plasmid,and the plasmid is taken up by the bacterium 
D) bacterial genome and plasmid are inserted into the genome of the cell containing the desired gene

Question 4

The diagram below summarizes ________.

Accepted Answer

A) gene cloning 
B) how a human could be cloned 
C) human gene therapy 
D) how a vaccine is made 
A) gene cloning 
B) how a human could be cloned 
C) human gene therapy 
D) how a vaccine is made

Question 5

The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to D) What is the approximate size of DNA molecule A?

Accepted Answer

A) 250 nucleotides 
B) 300 nucleotides 
C) 350 nucleotides 
D) 400 nucleotides 
A) 250 nucleotides 
B) 300 nucleotides 
C) 350 nucleotides 
D) 400 nucleotides

Question 6

FGA is one of the STRs that are used to compare DNA between different people.Why is FGA useful for comparing DNA between different people?

Accepted Answer

A) FGA varies in the number of repeats between different people. 
B) FGA varies in sequence between different people. 
C) FGA is only present in some peoples' genomes. 
D) FGA is present in different places in different peoples' genomes. 
A) FGA varies in the number of repeats between different people. 
B) FGA varies in sequence between different people. 
C) FGA is only present in some peoples' genomes. 
D) FGA is present in different places in different peoples' genomes.

Question 7

The world's first genetically engineered pharmaceutical product was ________.

Accepted Answer

A) humulin 
B) HGH 
C) tPA 
D) EPO 
A) humulin 
B) HGH 
C) tPA 
D) EPO

Question 8

A DNA fragment with a sticky end that reads -ATTCG will bind with another DNA fragment with a sticky end that reads ________.

Accepted Answer

A) TAAGC- 
B) CGGAT- 
C) GCCTA- 
D) ATTGC- 
A) TAAGC- 
B) CGGAT- 
C) GCCTA- 
D) ATTGC-

Question 9

To find the nucleotide sequence of human chromosomes,chromosomes had to be digested into small fragments and then ________.

Accepted Answer

A) centrifuged and electrophoresed 
B) fingerprinted 
C) cloned and sequenced 
D) restricted 
A) centrifuged and electrophoresed 
B) fingerprinted 
C) cloned and sequenced 
D) restricted

Question 10

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

Accepted Answer

A) 0 times 
B) 1 time 
C) 2 times 
D) 3 times 
A) 0 times 
B) 1 time 
C) 2 times 
D) 3 times

Question 11

Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

Accepted Answer

A) Humans and chimpanzees share a relatively recent common ancestor. 
B) Humans evolved from chimpanzees. 
C) Humans are unique and different from all other life forms. 
D) Humans are a more complex life form than chimpanzees. 
A) Humans and chimpanzees share a relatively recent common ancestor. 
B) Humans evolved from chimpanzees. 
C) Humans are unique and different from all other life forms. 
D) Humans are a more complex life form than chimpanzees.

Question 12

A vaccine works by ________.

Accepted Answer

A) inhibiting bacterial reproduction 
B) stimulating the immune system to develop lasting defenses 
C) killing cells infected with a virus 
D) preventing translation of mRNA molecules that code for disease-causing proteins 
A) inhibiting bacterial reproduction 
B) stimulating the immune system to develop lasting defenses 
C) killing cells infected with a virus 
D) preventing translation of mRNA molecules that code for disease-causing proteins

Question 13

One of your local newscasters sees these data and announces on the news that "Bt toxins are safe because they have no negative effects on any arthropods except for the corn borers." Do you agree with that statement?

Accepted Answer

A) Yes,because the data clearly show that the Bt toxin is harmless to arthropods other than the corn borer. 
B) Yes,because only the corn borer was affected when eating the Bt corn. 
C) No,because more mites and beetles died after eating Bt corn than after eating non-Bt corn. 
D) No,because these data were obtained from testing Bt on two species of mites and beetles; perhaps other arthropods may respond differently to Bt. 
A) Yes,because the data clearly show that the Bt toxin is harmless to arthropods other than the corn borer. 
B) Yes,because only the corn borer was affected when eating the Bt corn. 
C) No,because more mites and beetles died after eating Bt corn than after eating non-Bt corn. 
D) No,because these data were obtained from testing Bt on two species of mites and beetles; perhaps other arthropods may respond differently to Bt.

Question 14

Which of the following best defines the term "transgenic organism"?

Accepted Answer

A) an organism that is the first of its kind to bear a particular allele 
B) an organism in which a genetic defect has been corrected using recombinant DNA therapy 
C) an organism containing a gene from another species 
D) an organism containing genes from three or more species 
A) an organism that is the first of its kind to bear a particular allele 
B) an organism in which a genetic defect has been corrected using recombinant DNA therapy 
C) an organism containing a gene from another species 
D) an organism containing genes from three or more species

Question 15

Of these steps,which occurs first in the production of a recombinant plasmid?

Accepted Answer

A) cloning 
B) cutting DNA into fragments 
C) isolation of a plasmid from a bacterium 
D) reproduction of the engineered plasmid in bacteria 
A) cloning 
B) cutting DNA into fragments 
C) isolation of a plasmid from a bacterium 
D) reproduction of the engineered plasmid in bacteria

Question 16

Transgenic animals are currently used ________.

Accepted Answer

A) to produce potentially useful proteins 
B) as food 
C) as vectors for use in cloning human DNA 
D) all of the answer options are correct 
A) to produce potentially useful proteins 
B) as food 
C) as vectors for use in cloning human DNA 
D) all of the answer options are correct

Question 17

What name is given to a region of DNA that varies from person to person?

Accepted Answer

A) genetic marker 
B) short tandem repeat 
C) sticky end 
D) restriction fragment 
A) genetic marker 
B) short tandem repeat 
C) sticky end 
D) restriction fragment

Question 18

You are attempting to link an individual to a crime.The only evidence you have is a tiny drop of blood.How can you use this drop of blood to definitively make the association?

Accepted Answer

A) You can use the sample to determine the individual's blood type. 
B) You can use gel electrophoresis to determine the length of the DNA found in the sample. 
C) You can use PCR to increase the amount of DNA available for STR analysis. 
D) You can use the sample to check for the presence of the Rhesus factor. 
A) You can use the sample to determine the individual's blood type. 
B) You can use gel electrophoresis to determine the length of the DNA found in the sample. 
C) You can use PCR to increase the amount of DNA available for STR analysis. 
D) You can use the sample to check for the presence of the Rhesus factor.

Question 19

"Sticky ends" are produced as a result of the action of ________.

Accepted Answer

A) PCR 
B) DNA ligase 
C) restriction enzymes 
D) bacterial plasmids 
A) PCR 
B) DNA ligase 
C) restriction enzymes 
D) bacterial plasmids

Question 20

Of the following,which is the last step in the production of a recombinant DNA plasmid?

Accepted Answer

A) cloning 
B) using DNA ligase to join DNA fragments 
C) cutting the gene of interest into fragments 
D) allowing the reproduction of the bacterium bearing the recombinant plasmid 
A) cloning 
B) using DNA ligase to join DNA fragments 
C) cutting the gene of interest into fragments 
D) allowing the reproduction of the bacterium bearing the recombinant plasmid

Exam 12: DNA Technology

Which of the following is a genetically modified organism?

The scientific field that studies complete sets of genes is called ________.

When plasmids are used to produce a desired protein,the ________.

The diagram below summarizes ________.

The gel shown above includes a DNA ladder that can be used to estimate the sizes of DNA molecules.The ladder increases in 100 nucleotide increments,from 100 to 700.Four DNA molecules have been separated on this gel (labeled A to D) What is the approximate size of DNA molecule A?

FGA is one of the STRs that are used to compare DNA between different people.Why is FGA useful for comparing DNA between different people?

The world's first genetically engineered pharmaceutical product was ________.

A DNA fragment with a sticky end that reads -ATTCG will bind with another DNA fragment with a sticky end that reads ________.

To find the nucleotide sequence of human chromosomes,chromosomes had to be digested into small fragments and then ________.

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases.How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

A vaccine works by ________.

One of your local newscasters sees these data and announces on the news that "Bt toxins are safe because they have no negative effects on any arthropods except for the corn borers." Do you agree with that statement?

Which of the following best defines the term "transgenic organism"?

Of these steps,which occurs first in the production of a recombinant plasmid?

Transgenic animals are currently used ________.

What name is given to a region of DNA that varies from person to person?

You are attempting to link an individual to a crime.The only evidence you have is a tiny drop of blood.How can you use this drop of blood to definitively make the association?

"Sticky ends" are produced as a result of the action of ________.

Of the following,which is the last step in the production of a recombinant DNA plasmid?

Introduction: Biology Today

Essential Chemistry for Biology

The Molecules of Life

A Tour of the Cell

The Working Cell

Cellular Respiration: Obtaining Energy From Food

Photosynthesis: Using Light to Make Food

Cellular Reproduction: Cells From Cells

Patterns of Inheritance

The Structure and Function of Dna

How Genes Are Controlled

How Populations Evolve

How Biological Diversity Evolves

The Evolution of Microbial Life

The Evolution of Plants and Fungi

The Evolution of Animals

An Introduction to Ecology and the Biosphere

Population Ecology

Communities and Ecosystems

Unifying Concepts of Animal Structure and Function

Nutrition and Digestion

Circulation and Respiration

The Bodys Defenses

Hormones

Reproduction and Development

Nervous,Sensory,and Locomotor Systems

The Life of a Flowering Plant

The Working Plant

Filters