Exam 12: DNA Technology and Genomics

Which of the following statements about DNA technology is false?

In the process of human gene cloning using plasmids, the bacterial plasmid

The type of recombinant bacteria most often used to mass-produce genes is

Which of the following statements about nucleic acid probes is false?

Which of the following statements regarding DNA is false?

Golden Rice is golden in color because it is rich in

Some restriction enzymes do not leave sticky ends when cutting DNA molecules; rather, they cut a restriction site down the middle and leave "blunt-ended" DNA molecules, which do not have any single-stranded nucleotide extensions. Which of the following is not a likely outcome when trying to insert a gene into a plasmid when have both been cut with the same "blunt-ended" restriction enzyme?

A cDNA library differs from a genomic library in that

Which of the following is an example of a genetically modified organism but not a transgenic organism?

Use the figure below to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top. Approximately how many bases are in the DNA molecule that the arrow is pointing to?

Which of the following pieces of evidence would be considered the best for establishing biological relatedness?

"Sticky ends" are

Which step in this process requires use of restriction enzymes?

A transgenic animal is

The feature of "sticky ends" that makes them especially useful in DNA recombination is their ability to

After reading the paragraph below, answer the questions that follow. Four decades after the end of the Vietnam War, the remains of an Air Force pilot were discovered and returned to the United States. A search of Air Force records identified three families to which the remains might possibly belong. Each family had a surviving twin of a missing service member. The following STR profiles were obtained from the remains of the pilot and the surviving twins from the three families. -Based on analysis of the STR sites shown, which family is the missing pilot least likely to belong to?

Why is the whole-genome shotgun method currently the tool of choice for analyzing genomes?

The polymerase chain reaction relies upon unusual, heat-resistant ________ that were isolated from bacteria living in hot springs.

After reading the paragraphs below, answer the questions that follow. Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing and frequent lung infections. Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death). -A scientist produced a batch of recombinant DNase I in E. coli cells and a batch in mammalian cells. She placed 0.1 mg of the E. coli-derived DNase I in a vial containing a solution of DNA, and she placed 0.1 mg of the mammalian cell-derived DNase I in a separate vial containing the same solution of DNA. The initial viscosity of the DNA solutions was identical. What do you expect the viscosity of the DNA solutions to be after ten minutes have passed, and why?

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^)indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?