Question 1

Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis?

Accepted Answer

A) These enzymes prevent overexpression of critical proteins. 
B) Without ribonucleases, messenger RNA could leave one cell type and lead to excessive protein synthesis in a different cell type. 
C) When ribonucleases degrade RNA, the degradation products are recycled, making protein synthesis more energy efficient. 
D) The activity of these enzymes promotes increased translation of individual messenger RNAs so that fewer RNA molecules are needed for protein production. 
A) These enzymes prevent overexpression of critical proteins. 
B) Without ribonucleases, messenger RNA could leave one cell type and lead to excessive protein synthesis in a different cell type. 
C) When ribonucleases degrade RNA, the degradation products are recycled, making protein synthesis more energy efficient. 
D) The activity of these enzymes promotes increased translation of individual messenger RNAs so that fewer RNA molecules are needed for protein production. A

Question 2

After a protein is synthesized during translation, what further process or processes is/are needed for it to be fully functional?

Accepted Answer

A) No further processing beyond the linear arrangement of amino acids is required. 
B) Although minimal function can occur in the linear form, the protein is more active when it undergoes mitosis. 
C) The protein first twists into a secondary structure and then "folds" into a specific tertiary structure for activation and function. 
D) The initial protein produced is a "preprotein" that requires a series of depolarizations by electrical impulses for conversion to an active protein. 
A) No further processing beyond the linear arrangement of amino acids is required. 
B) Although minimal function can occur in the linear form, the protein is more active when it undergoes mitosis. 
C) The protein first twists into a secondary structure and then "folds" into a specific tertiary structure for activation and function. 
D) The initial protein produced is a "preprotein" that requires a series of depolarizations by electrical impulses for conversion to an active protein. C

Question 3

Which process occurs outside of the nucleus?

Accepted Answer

A) DNA transcription 
B) RNA transcription 
C) Splicing out of introns 
D) Translation of mRNA 
A) DNA transcription 
B) RNA transcription 
C) Splicing out of introns 
D) Translation of mRNA D

Question 4

What is the expected outcome when a person (twin A) experiences a large deletion of DNA in one of his noncoding regions and his monozygotic twin (twin B) doesnot?

Accepted Answer

A) DNA identification of each twin will be more specific. 
B) Only their somatic cells will remain identical at all loci. 
C) Only their germline cells will remain identical at all loci. 
D) They will now be dizygotic twins instead of monozygotic twins. 
A) DNA identification of each twin will be more specific. 
B) Only their somatic cells will remain identical at all loci. 
C) Only their germline cells will remain identical at all loci. 
D) They will now be dizygotic twins instead of monozygotic twins.

Question 5

How does an "anticodon" participate in protein synthesis?

Accepted Answer

A) Splicing out the introns to form a functional and mature messenger RNA 
B) Identifying which DNA strand is the "sense" strand to transcribe into RNA 
C) Ensuring the appropriate tRNA places the correct amino acid into the protein 
D) Interpreting the correct "stop" triplet or codon that signals for translation termination 
A) Splicing out the introns to form a functional and mature messenger RNA 
B) Identifying which DNA strand is the "sense" strand to transcribe into RNA 
C) Ensuring the appropriate tRNA places the correct amino acid into the protein 
D) Interpreting the correct "stop" triplet or codon that signals for translation termination

Question 6

How does a "codon" participate in protein synthesis?

Accepted Answer

A) Carrying amino acid for peptide bond attachment 
B) Ensuring that ribosomal RNA is securely wrapped around the mature mRNA 
C) Preventing microRNA from binding to mRNA and prematurely degrading it 
D) Indicating which amino acid is to be placed within the growing protein chain 
A) Carrying amino acid for peptide bond attachment 
B) Ensuring that ribosomal RNA is securely wrapped around the mature mRNA 
C) Preventing microRNA from binding to mRNA and prematurely degrading it 
D) Indicating which amino acid is to be placed within the growing protein chain

Question 7

How does an acquired mutation in a somatic cell gene leading to cancer development affect a person's ability to pass on a predisposition for that cancer typeto hisorher children?

Accepted Answer

A) The predisposition can only be passed on if the person with the somatic cell mutation is female. 
B) There is no risk of passing on a cancer predisposition to one's children from a somatic cell mutation. 
C) The risk for predisposition is dependent on which tissue type experienced the somatic mutation. 
D) Multiple somatic mutations are required for passing on a predisposition to cancer development. 
A) The predisposition can only be passed on if the person with the somatic cell mutation is female. 
B) There is no risk of passing on a cancer predisposition to one's children from a somatic cell mutation. 
C) The risk for predisposition is dependent on which tissue type experienced the somatic mutation. 
D) Multiple somatic mutations are required for passing on a predisposition to cancer development.

Question 8

Astrand of recently transcribed mRNA contains the following components: intron (1), intron (2), exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to appear in the mature mRNA?

Accepted Answer

A) 1, 2, 3, 4, 5, 6, 7, 8 
B) 2, 3, 4, 5, 6, 7 
C) 1, 2, 4, 8 
D) 3, 5, 6, 7 
A) 1, 2, 3, 4, 5, 6, 7, 8 
B) 2, 3, 4, 5, 6, 7 
C) 1, 2, 4, 8 
D) 3, 5, 6, 7

Question 9

Why are people who have poor DNA repair mechanisms at greater risk for cancer development?

Accepted Answer

A) Their cancers are usually resistant to chemotherapy. 
B) Their somatic mutations are more likely to be permanent. 
C) They have greater exposure to environmental carcinogens. 
D) They have sustained a mutational event in all cells and tissues. 
A) Their cancers are usually resistant to chemotherapy. 
B) Their somatic mutations are more likely to be permanent. 
C) They have greater exposure to environmental carcinogens. 
D) They have sustained a mutational event in all cells and tissues.

Question 10

How does the process of polyadenylation affect protein synthesis?

Accepted Answer

A) Binding to the antisense DNA strand to prevent inappropriate transcription 
B) Promoting attachment of ribosomes to the correct end of messenger RNA 
C) Linking the exons into the mature messenger RNA 
D) Signaling the termination of mRNA translation 
A) Binding to the antisense DNA strand to prevent inappropriate transcription 
B) Promoting attachment of ribosomes to the correct end of messenger RNA 
C) Linking the exons into the mature messenger RNA 
D) Signaling the termination of mRNA translation

Question 11

Jack and Jill go up a hill that has high levels of gamma radiation emission. Jack suffers 10 point mutational events in a noncoding region, and Jill suffers only one frameshift mutation in the insulin gene-coding region of all her pancreatic beta cells. What are the possible and probable outcomes of these events for both people?

Accepted Answer

A) Jack will have major deficiencies in the production of 10 proteins; Jill will have reduced insulin activity. 
B) Jack will have less functional proteins and an increased risk for cancer; Jill will have type 2 diabetes mellitus. 
C) Jack will have few, if any, effects on protein synthesis but will have more personal DNA markers; Jill will not produce any functional insulin and will have type 1 diabetes mellitus. 
D) Jack will not have any change in protein synthesis or function; Jill will have an increased risk for developing type 1 diabetes mellitus and can pass this risk on to her children. 
A) Jack will have major deficiencies in the production of 10 proteins; Jill will have reduced insulin activity. 
B) Jack will have less functional proteins and an increased risk for cancer; Jill will have type 2 diabetes mellitus. 
C) Jack will have few, if any, effects on protein synthesis but will have more personal DNA markers; Jill will not produce any functional insulin and will have type 1 diabetes mellitus. 
D) Jack will not have any change in protein synthesis or function; Jill will have an increased risk for developing type 1 diabetes mellitus and can pass this risk on to her children.

Question 12

What would be the consequence for protein synthesis if only limited amounts of adenine were available in a cell?

Accepted Answer

A) Increased rate of mRNA degradation 
B) Increased formation of mutation "hot spots" 
C) Decreased production of cellular proteins 
D) Decreased amounts of uracil in the cytoplasm 
A) Increased rate of mRNA degradation 
B) Increased formation of mutation "hot spots" 
C) Decreased production of cellular proteins 
D) Decreased amounts of uracil in the cytoplasm

Question 13

What makes a frameshift mutational event more serious than a point mutational event?

Accepted Answer

A) Frameshift mutations occur primarily in germline cells, and point mutations occur only in somatic cells. 
B) Frameshift mutations result in the deletion or addition of whole chromosomes (aneuploidy), and point mutations are undetectable at the chromosome level. 
C) The rate of frameshift mutations increases with aging because DNA repair mechanisms decline, whereas the rate of point mutations is unchanged with age. 
D) When the mutations occur in expressed genes, frameshift mutations always result in disruption of the gene function, whereas a point mutation can be silent. 
A) Frameshift mutations occur primarily in germline cells, and point mutations occur only in somatic cells. 
B) Frameshift mutations result in the deletion or addition of whole chromosomes (aneuploidy), and point mutations are undetectable at the chromosome level. 
C) The rate of frameshift mutations increases with aging because DNA repair mechanisms decline, whereas the rate of point mutations is unchanged with age. 
D) When the mutations occur in expressed genes, frameshift mutations always result in disruption of the gene function, whereas a point mutation can be silent.

Question 14

Which DNA segment deletion would cause a frameshift mutation?

Accepted Answer

A) TCT 
B) GAGTC 
C) TACTAC 
D) GCATGACCC 
A) TCT 
B) GAGTC 
C) TACTAC 
D) GCATGACCC

Question 15

What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis?

Accepted Answer

A) Transcription for DNA synthesis is rapidly followed by the process of translation. 
B) Transcription for protein synthesis has "greater fidelity" than does transcription for DNA synthesis. 
C) Transcription for protein synthesis occurs only in cells undergoing mitosis, and transcription for DNA synthesis occurs in both dividing and nondividing cells. 
D) Transcription for DNA synthesis occurs with both the "sense" and the "antisense" strands, while transcription for protein synthesis occurs with only the "antisense" strand. 
A) Transcription for DNA synthesis is rapidly followed by the process of translation. 
B) Transcription for protein synthesis has "greater fidelity" than does transcription for DNA synthesis. 
C) Transcription for protein synthesis occurs only in cells undergoing mitosis, and transcription for DNA synthesis occurs in both dividing and nondividing cells. 
D) Transcription for DNA synthesis occurs with both the "sense" and the "antisense" strands, while transcription for protein synthesis occurs with only the "antisense" strand.

Question 16

Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA

Accepted Answer

A) AUGGUUAUUA 
B) ACGCTCGATTATTT 
C) CGCUCGAUUAUUU 
D) AACGCUUGGUCUGAAUUUUAAUUU 
A) AUGGUUAUUA 
B) ACGCTCGATTATTT 
C) CGCUCGAUUAUUU 
D) AACGCUUGGUCUGAAUUUUAAUUU

Question 17

A new experimental drug has been developed that reduces the activity of microRNA in the beta cells of the pancreas of people with type 2 diabetes mellitus. Ifthisdrug was specific only for pancreatic beta cells, what would be its effect?

Accepted Answer

A) Increased production of insulin 
B) Decreased production of insulin 
C) Increased degradation of insulin 
D) Decreased degradation of insulin 
A) Increased production of insulin 
B) Decreased production of insulin 
C) Increased degradation of insulin 
D) Decreased degradation of insulin

Question 18

What is the best meaning for the term gene expression?

Accepted Answer

A) The location of a specific gene allele on a specific autosomal chromosome 
B) The specific trait or protein coded for by a single gene is actually present 
C) The ability of a single gene to code for more than one trait or characteristic 
D) The loss of a trait or characteristic from one family generation to the next generation 
A) The location of a specific gene allele on a specific autosomal chromosome 
B) The specific trait or protein coded for by a single gene is actually present 
C) The ability of a single gene to code for more than one trait or characteristic 
D) The loss of a trait or characteristic from one family generation to the next generation

Question 19

Which statement about the introns within one gene is correct?

Accepted Answer

A) These small pieces of DNA form microRNAs that regulate gene expression. 
B) They are part of the desert DNA composing the noncoding regions. 
C) When expressed, they induce posttranslational modifications. 
D) The introns of one gene may be the exons of another gene. 
A) These small pieces of DNA form microRNAs that regulate gene expression. 
B) They are part of the desert DNA composing the noncoding regions. 
C) When expressed, they induce posttranslational modifications. 
D) The introns of one gene may be the exons of another gene.

Question 20

Which process would be directly inhibited by a lack of conversion of thymine to uracil?

Accepted Answer

A) Translation 
B) Transcription 
C) MicroRNA silencing 
D) Posttranscriptional modification 
A) Translation 
B) Transcription 
C) MicroRNA silencing 
D) Posttranscriptional modification

Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis?

After a protein is synthesized during translation, what further process or processes is/are needed for it to be fully functional?

Which process occurs outside of the nucleus?

What is the expected outcome when a person (twin A) experiences a large deletion of DNA in one of his noncoding regions and his monozygotic twin (twin B) doesnot?

How does an "anticodon" participate in protein synthesis?

How does a "codon" participate in protein synthesis?

How does an acquired mutation in a somatic cell gene leading to cancer development affect a person's ability to pass on a predisposition for that cancer typeto hisorher children?

Astrand of recently transcribed mRNA contains the following components: intron (1), intron (2), exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to appear in the mature mRNA?

Why are people who have poor DNA repair mechanisms at greater risk for cancer development?

How does the process of polyadenylation affect protein synthesis?

What would be the consequence for protein synthesis if only limited amounts of adenine were available in a cell?

What makes a frameshift mutational event more serious than a point mutational event?

Which DNA segment deletion would cause a frameshift mutation?

What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis?

Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA

A new experimental drug has been developed that reduces the activity of microRNA in the beta cells of the pancreas of people with type 2 diabetes mellitus. Ifthisdrug was specific only for pancreatic beta cells, what would be its effect?

What is the best meaning for the term gene expression?

Which statement about the introns within one gene is correct?

Which process would be directly inhibited by a lack of conversion of thymine to uracil?

DNA Structure and Function

Genetic Influence on Cell Division, Differentiation, and Gametogenesis

Patterns of Inheritance

Epigenetic Influences on Gene Expression

Autosomal Inheritance and Disorders

Sex Chromosome and Mitochondrial Inheritance and Disorders

Family History and Pedigree Construction

Congenital Anomalies, Basic Dysmorphology, and Genetic Assessment

Enzyme and Collagen Disorders

Common Childhood-Onset Genetic Disorders

Common Adult-Onset Disorders

Cardiovascular Disorders

The Genetics of Cancer

Genetic Contributions to Psychiatric and Behavioral Disorders

Genetic and Genomic Testing

Assessing Genomic Variation in Drug Response

Health Professionals and Genomic Care

Financial, Ethical, Legal, and Social Considerations

Genetic and Genomic Variation

Filters

Exam 2: Protein Synthesis

Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis?

After a protein is synthesized during translation, what further process or processes is/are needed for it to be fully functional?

Which process occurs outside of the nucleus?

What is the expected outcome when a person (twin A) experiences a large deletion of DNA in one of his noncoding regions and his monozygotic twin (twin B) doesnot?

How does an "anticodon" participate in protein synthesis?

How does a "codon" participate in protein synthesis?

How does an acquired mutation in a somatic cell gene leading to cancer development affect a person's ability to pass on a predisposition for that cancer typeto hisorher children?

Astrand of recently transcribed mRNA contains the following components: intron (1), intron (2), exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to appear in the mature mRNA?

Why are people who have poor DNA repair mechanisms at greater risk for cancer development?

How does the process of polyadenylation affect protein synthesis?

What would be the consequence for protein synthesis if only limited amounts of adenine were available in a cell?

What makes a frameshift mutational event more serious than a point mutational event?

Which DNA segment deletion would cause a frameshift mutation?

What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis?

Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA

A new experimental drug has been developed that reduces the activity of microRNA in the beta cells of the pancreas of people with type 2 diabetes mellitus. Ifthisdrug was specific only for pancreatic beta cells, what would be its effect?

What is the best meaning for the term gene expression?

Which statement about the introns within one gene is correct?

Which process would be directly inhibited by a lack of conversion of thymine to uracil?

DNA Structure and Function

Genetic Influence on Cell Division, Differentiation, and Gametogenesis

Patterns of Inheritance

Epigenetic Influences on Gene Expression

Autosomal Inheritance and Disorders

Sex Chromosome and Mitochondrial Inheritance and Disorders

Family History and Pedigree Construction

Congenital Anomalies, Basic Dysmorphology, and Genetic Assessment

Enzyme and Collagen Disorders

Common Childhood-Onset Genetic Disorders

Common Adult-Onset Disorders

Cardiovascular Disorders

The Genetics of Cancer

Genetic Contributions to Psychiatric and Behavioral Disorders

Genetic and Genomic Testing

Assessing Genomic Variation in Drug Response

Health Professionals and Genomic Care

Financial, Ethical, Legal, and Social Considerations

Genetic and Genomic Variation

Filters