Exam 12: Dna Technology

What is the best definition for recombinant DNA?

The state of human gene therapy today is that ________.

In what type of organism was the CRISPR-Cas9 system discovered?

FGA is one of the STRs that are used to compare DNA between different people. Why is FGA useful for comparing DNA between different people?

Of these steps, which one occurs earliest in the process of producing recombinant DNA?

What is the definition of a genetically modified organism?

Which enzyme is used to bind DNA fragments together?

Cutting DNA with a particular restriction enzyme produces DNA fragments that can be separated by ________.

HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA

When plasmids are used to produce a desired protein, the ________.

Approximately what percentage of the human genome consists of noncoding DNA?

Cystic fibrosis is a serious respiratory disease that is caused by the expression of a mutant form of the cystic fibrosis transmembrane regulator (CFTR)protein. Suppose that gene therapy was being used to attempt to treat cystic fibrosis. What biological component would be required for this treatment?

Golden rice 2 is a genetically modified form of rice that was developed to treat what nutritional deficiency?

Gel electrophoresis separates DNA fragments on the basis of differences in their ________.

You are attempting to link an individual to a crime. The only evidence you have is a tiny drop of blood. How can you use this drop of blood to definitively make the association?

Which of these statements can be logically inferred from the amount of DNA shared by chimpanzees and humans?

What evidence led to the confirmation that Albert DeSalvo was the Boston Strangler?

Scenario Patients with organ failure or severe diseases may need organ transplants. However, there is often a long waitlist for certain organs, and patients may not be able to acquire a human organ transplant in time. To address this issue, pigs have been studied as a potential source of organs to use for transplants because pig organs are similar in size to human organs and are easy to obtain. However, a major health concern that needs to be addressed before pig organ transplantation becomes viable is the prevention of bacterial or viral transmission from pig organs to the human patient. One pig virus that is particularly difficult to prevent from being transmitted is porcine endogenous retrovirus (PERV). At some point in time, PERV infected pig eggs or sperm and thus incorporated its own genome into the pig genome, and all species of pigs carry the PERV genome to some extent. Therefore, if a pig kidney is used for a human transplant, all of the pig kidney cells will have the DNA for PERV, and these could possibly infect the human host. To prevent transmission of PERV, researchers have recently used CRISPR-Cas9 gene editing to introduce mutations in the pol gene. The pol gene codes for the enzyme reverse transcriptase that functions to produce PERV from the pig genome, thus preventing PERV from being produced. As of late 2017, 37 CRISPR-edited piglets were born and 15 were still alive. However, their organs have yet to be transplanted into humans. -Suppose that the researchers targeted the DNA polymerase gene instead of the pol gene. What do you think the most likely outcome would have been?

There are many ethical dilemmas raised by DNA technology and knowledge of the human genome. Choose the exception.

What is the definition of a "transgenic organism?"