Exam 13: Translation of Mrna

A tRNA that has an amino acid attached is called ________.

The primary structure of a protein is directly associated with ________.

What site on the ribosome is primarily responsible for holding the growing polypeptide?

61 different tRNAs are required for translation both in vivo and in vitro.

Select all stop codons.

Select the codon that is not synonymous with CUU.

Taking into account your knowledge of wobble rules, select all anticodons that can pair with the codon 5'-UAC-3' (Check all that apply).

The peptidyl transferase is a component of

During elongation, the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

The anticodon on the mRNA recognizes the codon on the tRNA.

The structure of the ribosome is uniform throughout a eukaryotic cell.

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

Suppose you performed a triplet binding assay with the triplet 5'-UAA-3'. What radiolabeled amino acids do you expect to find bound to the filter?

A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?

All mature polypeptides contain a methionine at the N-terminus.

What is responsible for binding the initiator tRNA in eukaryotes?

Where are the ribosomal subunits assembled in eukaryotes?

A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than

The genetic code is nearly universal in nuclear DNA from bacteria to mammals.