Question 1

Choose the INCORRECT statement.

Accepted Answer

A) The nucleus of the cell contains chromosomes that cause replication from one generation to the next. 
B) Genes are portions of the chromosome that carry specific traits. 
C) The usual form for DNA is a double helix. 
D) Nucleic acids are made up of heterocyclic amines,a 5-carbon sugar and phosphate groups. 
E) The bases in the two chains of the double helix are randomly paired. 
A) The nucleus of the cell contains chromosomes that cause replication from one generation to the next. 
B) Genes are portions of the chromosome that carry specific traits. 
C) The usual form for DNA is a double helix. 
D) Nucleic acids are made up of heterocyclic amines,a 5-carbon sugar and phosphate groups. 
E) The bases in the two chains of the double helix are randomly paired.

Question 2

In the sequence Arg-Pro-Leu-Gln,which amino acid contains the C-terminal group?

Accepted Answer

A) proline 
B) leucine 
C) glutamine 
D) arginine 
A) proline 
B) leucine 
C) glutamine 
D) arginine

Question 3

A protein molecule has a molecular weight of 7.70 × 105 g/mol.The mass percent of magnesium in the protein is 3.16 × 10-3%.How many magnesium atom(s)are there in one protein molecule?

Accepted Answer

A) 1 
B) 2 
C) 3 
D) 24 
E) 5 
A) 1 
B) 2 
C) 3 
D) 24 
E) 5

Question 4

All amino acids always contain one chemical element which is absent in the structures of carbohydrates.This element is ________.

Accepted Answer

A) carbon 
B) nitrogen 
C) phosphorus 
D) sulfur 
E) oxygen 
A) carbon 
B) nitrogen 
C) phosphorus 
D) sulfur 
E) oxygen

Question 5

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication.What would be the sequence of the complementary DNA strand produced during the replication of this strand?
ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

Accepted Answer

A) GCCATATCCGCCTATACCGGGAATTCTCAGCA 
B) CGGTATAGGCGGATATGGCCCTTAAGAGTCGT 
C) ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT 
D) TAAGCGCAATAACGCGAATTTCCGGAGAGTAG 
E) TAACGCGAATAAGCGCAATTTCCGGAGACTAC 
A) GCCATATCCGCCTATACCGGGAATTCTCAGCA 
B) CGGTATAGGCGGATATGGCCCTTAAGAGTCGT 
C) ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT 
D) TAAGCGCAATAACGCGAATTTCCGGAGAGTAG 
E) TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 6

The hydrolysis of tristearin produces the soap potassium stearate and ________.

Accepted Answer

The answer of The hydrolysis of tristearin produces the soap...

Question 7

Triglycerides are composed of which two compounds linked through an ester functionality?

Accepted Answer

A) glycerol and long chain monoalcohols 
B) glycine and carboxylic acids 
C) glycerol and long-chain monocarboxylic acids 
D) lauric acid and glucose 
E) ethylene glycol and dicarboxylic acids 
A) glycerol and long chain monoalcohols 
B) glycine and carboxylic acids 
C) glycerol and long-chain monocarboxylic acids 
D) lauric acid and glucose 
E) ethylene glycol and dicarboxylic acids

Question 8

What is the common name of the following triglyceride?

Accepted Answer

A) glyceryl myristolaurolinoleneate 
B) glyceryl palmitostearooleate 
C) glycero laurostearooleate 
D) glycero palmitostearooleate 
E) glyco stearooleolaurate 
A) glyceryl myristolaurolinoleneate 
B) glyceryl palmitostearooleate 
C) glycero laurostearooleate 
D) glycero palmitostearooleate 
E) glyco stearooleolaurate

Question 9

Choose the INCORRECT statement.

Accepted Answer

A) A 50/50 mixture of two enantiomers is a racemic mixture. 
B) A racemic mixture will not rotate plane polarized light. 
C) Separating the optical isomers is called resolution. 
D) Dextrorotatory optical isomers are designated as (-). 
E) Molecules that will rotate plane polarized light are optically active. 
A) A 50/50 mixture of two enantiomers is a racemic mixture. 
B) A racemic mixture will not rotate plane polarized light. 
C) Separating the optical isomers is called resolution. 
D) Dextrorotatory optical isomers are designated as (-). 
E) Molecules that will rotate plane polarized light are optically active.

Question 10

Amino acids are joined into proteins by:

Accepted Answer

A) a 3'-5' linkage 
B) a beta 1-4 linkage 
C) DNA 
D) an ester 
E) peptide bonds 
A) a 3'-5' linkage 
B) a beta 1-4 linkage 
C) DNA 
D) an ester 
E) peptide bonds

Question 11

Choose the INCORRECT statement.

Accepted Answer

A) Glucose,galactose and mannose exist in straight-chain and in ring structures. 
B) Two monosaccharides combine by losing a water molecule to form a disaccharide. 
C) The important natural disaccharides are maltose,cellobiose,lactose and sucrose. 
D) Glycogen is the reserve carbohydrate of animals. 
E) Glycogen cannot be broken down by human digestion. 
A) Glucose,galactose and mannose exist in straight-chain and in ring structures. 
B) Two monosaccharides combine by losing a water molecule to form a disaccharide. 
C) The important natural disaccharides are maltose,cellobiose,lactose and sucrose. 
D) Glycogen is the reserve carbohydrate of animals. 
E) Glycogen cannot be broken down by human digestion.

Question 12

How many tripeptides can be formed from serine,alanine,and glycine?

Accepted Answer

A) 6 
B) 4 
C) 8 
D) 10 
A) 6 
B) 4 
C) 8 
D) 10

Question 13

What is the zwitterion form of the amino acid cysteine?

Accepted Answer

A) NH3+-CH(CH2SH)CO2- 
B) NH3+-CH(CH2S-)CO2H 
C) NH3+-CH(CH2SH)CO2H 
D) NH2-CH(CH2SH)CO2- 
A) NH3+-CH(CH2SH)CO2- 
B) NH3+-CH(CH2S-)CO2H 
C) NH3+-CH(CH2SH)CO2H 
D) NH2-CH(CH2SH)CO2-

Question 14

Enantiomers are non-superimposable mirror images.

Accepted Answer

A) True 
 B)False

Question 15

β-D-N-Acetylglucosamine (shown below)is a glycose found in many glycoproteins which are an integral part of cell membranes.One chair conformation of this glycose is shown below.How many of the hydroxyl groups on the six-membered ring occupy equatorial positions?

Accepted Answer

A) 2 
B) 4 
C) 0 
D) 3 
E) 1 
A) 2 
B) 4 
C) 0 
D) 3 
E) 1

Question 16

Metabolic reactions in which substances are broken down are referred to as anabolism.

Accepted Answer

A) True 
 B)False

Question 17

Choose the INCORRECT statement.

Accepted Answer

A) Peptides are amino acids joined by a peptide bond. 
B) A tripeptide has three peptide bonds. 
C) A protein is hydrolyzed to a mixture of α-amino acids. 
D) An α-amino acid is a carboxylic acid with an amine group on the α carbon atom. 
E) Proteins are a polymer of amino acid units. 
A) Peptides are amino acids joined by a peptide bond. 
B) A tripeptide has three peptide bonds. 
C) A protein is hydrolyzed to a mixture of α-amino acids. 
D) An α-amino acid is a carboxylic acid with an amine group on the α carbon atom. 
E) Proteins are a polymer of amino acid units.

Question 18

Which one of the following amino acids contains a hydrophobic side chain?

Accepted Answer

A) valine 
B) histidine 
C) glutamine 
D) glutamic acid 
A) valine 
B) histidine 
C) glutamine 
D) glutamic acid

Question 19

Which of the following do humans have difficulty digesting?

Accepted Answer

A) cellulose 
B) proteins 
C) vegetable oils 
D) vegetable starch 
E) animal fats 
A) cellulose 
B) proteins 
C) vegetable oils 
D) vegetable starch 
E) animal fats

Question 20

How many peptide bonds are present in a hexapeptide?

Accepted Answer

A) 4 
B) 5 
C) 6 
D) 7 
E) 3 
A) 4 
B) 5 
C) 6 
D) 7 
E) 3

Exam 28: Chemistry of the Living State

Choose the INCORRECT statement.

In the sequence Arg-Pro-Leu-Gln,which amino acid contains the C-terminal group?

A protein molecule has a molecular weight of 7.70 × 105 g/mol.The mass percent of magnesium in the protein is 3.16 × 10-3%.How many magnesium atom(s)are there in one protein molecule?

All amino acids always contain one chemical element which is absent in the structures of carbohydrates.This element is ________.

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication.What would be the sequence of the complementary DNA strand produced during the replication of this strand? ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

The hydrolysis of tristearin produces the soap potassium stearate and ________.

Triglycerides are composed of which two compounds linked through an ester functionality?

What is the common name of the following triglyceride?

Choose the INCORRECT statement.

Amino acids are joined into proteins by:

Choose the INCORRECT statement.

How many tripeptides can be formed from serine,alanine,and glycine?

What is the zwitterion form of the amino acid cysteine?

Enantiomers are non-superimposable mirror images.

β-D-N-Acetylglucosamine (shown below)is a glycose found in many glycoproteins which are an integral part of cell membranes.One chair conformation of this glycose is shown below.How many of the hydroxyl groups on the six-membered ring occupy equatorial positions?

Metabolic reactions in which substances are broken down are referred to as anabolism.

Choose the INCORRECT statement.

Which one of the following amino acids contains a hydrophobic side chain?

Which of the following do humans have difficulty digesting?

How many peptide bonds are present in a hexapeptide?

Matter: Its Properties and Measurement

Atoms and the Atomic Theory

Chemical Compounds

Chemical Reactions

Introduction to Reactions in Aqueous Solutions

Gases

Thermochemistry

Electrons in Atoms

The Periodic Table and Some Atomic Properties

Chemical Bonding I: Basic Concepts

Chemical Bonding Ii: Valence Bond and Molecular Orbital Theories

Intermolecular Forces: Liquids and Solids

Spontaneous Change: Entropy and Gibbs Energy

Solutions and Their Physical Properties

Principles of Chemical Equilibrium

Acids and Bases

Additional Aspects of Acidbase Equilibria

Solubility and Complex-Ion Equilibria

Electrochemistry

Chemical Kinetics

Chemistry of the Main-Group Elements I: Groups 1,2,13,and 14

Chemistry of the Main-Group Elements Ii: Groups 18,17,16,15,and Hydrogen

The Transition Elements

Complex Ions and Coordination Compounds

Nuclear Chemistry

Structures of Organic Compounds

Reactions of Organic Compounds

Filters

A protein molecule has a molecular weight of 7.70 × 10⁵g/mol.The mass percent of magnesium in the protein is 3.16 × 10^-3%.How many magnesium atom(s)are there in one protein molecule?