Question 1

An elongating ribosome is bound to appropriate tRNAs in both the A and the P sites and is ready for peptidyl transfer. What happens next?

Accepted Answer

A)  The carboxyl end of the polypeptide chain is released from the P-site tRNA and joined to the free amino group of the amino acid linked to the A-site tRNA. 
B)  The amino end of the polypeptide chain is released from the P-site tRNA and joined to the free carboxyl group of the amino acid linked to the A-site tRNA. 
C)  The carboxyl end of the amino acid is released from the A-site tRNA and joined to the free amino group of the polypeptide chain linked to the P-site tRNA. 
D)  The amino end of the amino acid is released from the A-site tRNA and joined to the free carboxyl group of the polypeptide chain linked to the P-site tRNA. 
A)  The carboxyl end of the polypeptide chain is released from the P-site tRNA and joined to the free amino group of the amino acid linked to the A-site tRNA. 
B)  The amino end of the polypeptide chain is released from the P-site tRNA and joined to the free carboxyl group of the amino acid linked to the A-site tRNA. 
C)  The carboxyl end of the amino acid is released from the A-site tRNA and joined to the free amino group of the polypeptide chain linked to the P-site tRNA. 
D)  The amino end of the amino acid is released from the A-site tRNA and joined to the free carboxyl group of the polypeptide chain linked to the P-site tRNA.

Question 2

Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?

Accepted Answer

A)  Ribosome assembly 
B)  rRNA gene transcription 
C)  Telomerase assembly 
D)  tRNA processing 
E)  All of the above 
A)  Ribosome assembly 
B)  rRNA gene transcription 
C)  Telomerase assembly 
D)  tRNA processing 
E)  All of the above

Question 3

Which of the following nucleotides is hydrolyzed in both transcription and in translation elongation?

Accepted Answer

A)  ATP 
B)  GTP 
C)  TTP 
D)  UTP 
E)  CTP 
A)  ATP 
B)  GTP 
C)  TTP 
D)  UTP 
E)  CTP

Question 4

In the following representation of a single-stranded RNA molecule, the nucleotide residues are drawn as gray circles, while base-pairing interactions between them are indicated by dashed lines. The structure of this RNA molecule has...

Accepted Answer

A)  one hairpin loop and one pseudoknot. 
B)  one pseudoknot only. 
C)  three hairpin loops and a four-stem junction. 
D)  two hairpin loops and a three-nucleotide bulge. 
E)  three hairpin loops. 
A)  one hairpin loop and one pseudoknot. 
B)  one pseudoknot only. 
C)  three hairpin loops and a four-stem junction. 
D)  two hairpin loops and a three-nucleotide bulge. 
E)  three hairpin loops.

Question 5

Sort the following events in the order that they occur during transcription initiation in Escherichia coli. Your answer would be a four-letter string composed of letters A to D only; e.g. DCAB.
(A)	Abortive initiation trials
(B)	? Factor release from the RNA polymerase holoenzyme
(C)	Binding of the holoenzyme to the promoter in the "closed" complex
(D)	Formation of the transcription bubble

Accepted Answer

In bacterial transcription initiation,

Question 6

For the bacterial transcription machinery, which of the following mRNA sequences would you expect to constitute a potent transcriptional termination signal? Note that the two underlined regions in each sequence are complementary to each other.

Accepted Answer

A)  5'... UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU...3' 
B)  5'... UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU...3' 
C)  5'... UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA...3' 
D)  5'... CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA...3' 
A)  5'... UGGCCCAGUCGGAAGACUGGGCCUUUUGUUUU...3' 
B)  5'... UGGCCCAGUCGGAAGACUGGGCCCGCGGAGCU...3' 
C)  5'... UUUUGUUUUAGGCCCAGUCGGAAGACUGGGCCA...3' 
D)  5'... CGCGGAGCUAGGCCCAGUCGGAAGACUGGGCCA...3'

Question 7

Which of the following types of noncoding RNA chiefly functions in the processing and chemical modification of ribosomal RNAs (rRNAs)?

Accepted Answer

A)  Small nuclear RNAs (snRNAs) 
B)  Small nucleolar RNAs (snoRNAs) 
C)  Small interfering RNAs (siRNAs) 
D)  Transfer RNAs (tRNAs) 
E)  MicroRNAs (miRNAs) 
A)  Small nuclear RNAs (snRNAs) 
B)  Small nucleolar RNAs (snoRNAs) 
C)  Small interfering RNAs (siRNAs) 
D)  Transfer RNAs (tRNAs) 
E)  MicroRNAs (miRNAs)

Question 8

The sequence of a region of DNA around the 5? end of a gene in Escherichia coli is shown below. The -10 hexamer and the transcription start site are highlighted. What would be the sequence of the first 10 nucleotides of the mRNA transcribed from this gene? Write down the sequence from 5? to 3?, e.g. CGGAUAAACT.
5?…GCGCTTGGTATAATCGCTGGGGGTCAAAGAT…3?

Accepted Answer

The mRNA sequence starts from the trans

Question 9

What is the function of the 19S cap in the proteasome complex?

Accepted Answer

A)  Recognizing the proteins that will be degraded 
B)  Unfolding the proteins that will be degraded and threading them into the central 20S cylinder for digestion 
C)  Removing the polyubiquitin chain from the proteins that will be degraded 
D)  Hydrolyzing ATP to make the digestion process highly efficient 
E)  All of the above 
A)  Recognizing the proteins that will be degraded 
B)  Unfolding the proteins that will be degraded and threading them into the central 20S cylinder for digestion 
C)  Removing the polyubiquitin chain from the proteins that will be degraded 
D)  Hydrolyzing ATP to make the digestion process highly efficient 
E)  All of the above

Question 10

As an mRNA molecule is processed in the nucleus, it loses some proteins and binds to new ones, some of which are used in mRNA surveillance pathways. The presence of which of the following molecules on an mRNA is a signal that the mRNA is still NOT ready for nuclear export?

Accepted Answer

A)  Cap-binding complex 
B)  Exon junction complex 
C)  snRNPs used in splicing 
D)  poly-A-binding proteins 
E)  SR proteins 
A)  Cap-binding complex 
B)  Exon junction complex 
C)  snRNPs used in splicing 
D)  poly-A-binding proteins 
E)  SR proteins

Question 11

Which of the following better describes a typical, actively translated mRNA in its journey from the nucleus to the cytosol?

Accepted Answer

A)  Initially in a circular conformation, the mRNA linearizes, enters the cytosol (5' end first), and remains linear. 
B)  Initially in a circular conformation, the mRNA linearizes, enters the cytosol (3' end first), and remains linear. 
C)  Initially linear, the mRNA enters the cytosol (5' end first), and adopts a circular conformation. 
D)  Initially linear, the mRNA enters the cytosol (3' end first), and adopts a circular conformation. 
E)  Initially linear, the mRNA enters the cytosol (3' end first), and remains linear. 
A)  Initially in a circular conformation, the mRNA linearizes, enters the cytosol (5' end first), and remains linear. 
B)  Initially in a circular conformation, the mRNA linearizes, enters the cytosol (3' end first), and remains linear. 
C)  Initially linear, the mRNA enters the cytosol (5' end first), and adopts a circular conformation. 
D)  Initially linear, the mRNA enters the cytosol (3' end first), and adopts a circular conformation. 
E)  Initially linear, the mRNA enters the cytosol (3' end first), and remains linear.

Question 12

Eukaryotic pre-mRNAs undergo a number of modifications such as capping at the 5' end. A 5' cap...

Accepted Answer

A)  consists of a modified terminal adenine nucleotide. 
B)  has a 3'-to-5' linkage between the terminal nucleotide and the 5' end of the pre-mRNA. 
C)  contains a triphosphate bridge between the terminal base and the 5' end of the pre-mRNA. 
D)  carries a negative charge in the terminal base due to methylation. 
E)  is identical for all mRNAs that are transcribed by RNA polymerase II. 
A)  consists of a modified terminal adenine nucleotide. 
B)  has a 3'-to-5' linkage between the terminal nucleotide and the 5' end of the pre-mRNA. 
C)  contains a triphosphate bridge between the terminal base and the 5' end of the pre-mRNA. 
D)  carries a negative charge in the terminal base due to methylation. 
E)  is identical for all mRNAs that are transcribed by RNA polymerase II.

Question 13

After the first and before the second chemical step of RNA splicing, the intron of the pre-mRNA...

Accepted Answer

A)  is still covalently connected to the 3' exon and has an internal branch in the shape of a lariat. 
B)  is still covalently connected to the 3' exon and is linear. 
C)  is still covalently connected to the 5' exon and has an internal branch in the shape of a lariat. 
D)  is still covalently connected to the 5' exon and is linear. 
E)  is still covalently connected to both of its flanking exons and is linear. 
A)  is still covalently connected to the 3' exon and has an internal branch in the shape of a lariat. 
B)  is still covalently connected to the 3' exon and is linear. 
C)  is still covalently connected to the 5' exon and has an internal branch in the shape of a lariat. 
D)  is still covalently connected to the 5' exon and is linear. 
E)  is still covalently connected to both of its flanking exons and is linear.

Question 14

Indicate true (T) and false (F) statements below regarding the RNA world hypothesis. Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF.
( )	According to this hypothesis, RNA in primitive cells was responsible for storing genetic information, while proteins were responsible for the catalysis of chemical reactions.
( )	The existence of natural ribozymes supports this hypothesis.
( )	In support of this hypothesis, all peptides in present-day cells are made by the ribosome.
( )	All present-day cells use DNA as their hereditary material.

Accepted Answer

The hereditary material in all present

Question 15

A primary mRNA transcript with three exons is depicted below. Which of the following mature mRNA products of this transcript is a result of exon skipping?

Accepted Answer

A)    
B)    
C)    
D)    
E)    
A)    
B)    
C)    
D)    
E)

Question 16

Due to their high transcription rate, active ribosomal RNA (rRNA) genes can be easily distinguished in electron micrographs of chromatin spreads. They have a characteristic "Christmas tree" appearance, where the DNA template is the "trunk" of the tree and the nascent RNA transcripts form closely packed "branches." At the base of each branch is an RNA polymerase extending that branch, while RNA processing complexes at the tip of the branch form terminal "ornaments." The top of the tree represents the ... of the rRNA gene, and the "ornaments" are at the ... end of the nascent rRNA molecules.

Accepted Answer

A)  end; 3' 
B)  end; 5' 
C)  beginning; either 3' or 5' 
D)  beginning; 3' 
E)  beginning; 5' 
A)  end; 3' 
B)  end; 5' 
C)  beginning; either 3' or 5' 
D)  beginning; 3' 
E)  beginning; 5'

Question 17

Each aminoacyl-tRNA synthetase activates a certain amino acid by attaching it to its corresponding tRNA(s) through a high-energy linkage...

Accepted Answer

A)  between the amino group of the amino acid and the 3' hydroxyl group of the tRNA. 
B)  between the amino group of the amino acid and the 5' hydroxyl group of the tRNA. 
C)  between the carboxyl group of the amino acid and the 3' or 2' hydroxyl group of the tRNA. 
D)  between the carboxyl group of the amino acid and the 5' hydroxyl group of the tRNA. 
E)  between the amino group of the amino acid and the 3' or 2' hydroxyl group of the tRNA. 
A)  between the amino group of the amino acid and the 3' hydroxyl group of the tRNA. 
B)  between the amino group of the amino acid and the 5' hydroxyl group of the tRNA. 
C)  between the carboxyl group of the amino acid and the 3' or 2' hydroxyl group of the tRNA. 
D)  between the carboxyl group of the amino acid and the 5' hydroxyl group of the tRNA. 
E)  between the amino group of the amino acid and the 3' or 2' hydroxyl group of the tRNA.

Question 18

How many ATP molecules must be hydrolyzed by the proteasome for the digestion of a protein that has been tagged for degradation with a polyubiquitin chain?

Accepted Answer

A)  None; the digestion does not require ATP hydrolysis and is exergonic 
B)  One 
C)  Two 
D)  Ten 
E)  Many; the number depends on the specific protein 
A)  None; the digestion does not require ATP hydrolysis and is exergonic 
B)  One 
C)  Two 
D)  Ten 
E)  Many; the number depends on the specific protein

Question 19

Indicate true (T) and false (F) statements below regarding the accuracy of translation by the ribosome. Your answer would be a four-letter string composed of letters T and F only, e.g. TFFF.
( )	The difference in the binding affinity of a codon to a correct versus incorrect anticodon CANNOT by itself account for the high accuracy of translation.
( )	GTP hydrolysis by EF-Tu both speeds up translation and increases its accuracy.
( )	The ribosome can detect correct Watson-Crick base-pairing between the codon and anticodon in the A site, and consequently trigger GTP hydrolysis by EF-Tu.
( )	Even after GTP hydrolysis by EF-Tu, the ribosome can prevent wrong amino acid incorporation by kinetic proofreading.

Accepted Answer

The difference in affinity between cor

Question 20

In the following qualitative histogram, which two curves better correspond to human exon and intron length distributions, respectively?

Accepted Answer

A)  Curves 1 and 2 
B)  Curves 2 and 1 
C)  Curves 2 and 3 
D)  Curves 3 and 2 
E)  Curves 3 and 1 
A)  Curves 1 and 2 
B)  Curves 2 and 1 
C)  Curves 2 and 3 
D)  Curves 3 and 2 
E)  Curves 3 and 1

An elongating ribosome is bound to appropriate tRNAs in both the A and the P sites and is ready for peptidyl transfer. What happens next?

Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?

Which of the following nucleotides is hydrolyzed in both transcription and in translation elongation?

In the following representation of a single-stranded RNA molecule, the nucleotide residues are drawn as gray circles, while base-pairing interactions between them are indicated by dashed lines. The structure of this RNA molecule has...

For the bacterial transcription machinery, which of the following mRNA sequences would you expect to constitute a potent transcriptional termination signal? Note that the two underlined regions in each sequence are complementary to each other.

Which of the following types of noncoding RNA chiefly functions in the processing and chemical modification of ribosomal RNAs (rRNAs)?

What is the function of the 19S cap in the proteasome complex?

As an mRNA molecule is processed in the nucleus, it loses some proteins and binds to new ones, some of which are used in mRNA surveillance pathways. The presence of which of the following molecules on an mRNA is a signal that the mRNA is still NOT ready for nuclear export?

Which of the following better describes a typical, actively translated mRNA in its journey from the nucleus to the cytosol?

Eukaryotic pre-mRNAs undergo a number of modifications such as capping at the 5' end. A 5' cap...

After the first and before the second chemical step of RNA splicing, the intron of the pre-mRNA...

A primary mRNA transcript with three exons is depicted below. Which of the following mature mRNA products of this transcript is a result of exon skipping?

Each aminoacyl-tRNA synthetase activates a certain amino acid by attaching it to its corresponding tRNA(s) through a high-energy linkage...

How many ATP molecules must be hydrolyzed by the proteasome for the digestion of a protein that has been tagged for degradation with a polyubiquitin chain?

In the following qualitative histogram, which two curves better correspond to human exon and intron length distributions, respectively?

Cells and Genomes

Cell Chemistry and Bioenergetics

Proteins

DNA, Chromosomes, and Genomes

DNA Replication, Repair, and Recombination

Control of Gene Expression

Analyzing Cells, Molecules, and Systems

Visualizing Cells

Membrane Structure

Membrane Transport of Small Molecules and the Electrical Properties of Membranes

Intracellular Compartments and Protein Sorting

Intracellular Membrane Traffic

Energy Conversion: Mitochondria and Chloroplasts

Cell Signaling

The Cytoskeleton

The Cell Cycle

Cell Death

Cell Junctions and the Extracellular Matrix

Cancer

Development of Multicellular Organisms

Stem Cells and Tissue Renewal

Pathogens and Infection

The Innate and Adaptive Immune Systems

Filters

Exam 6: How Cells Read the Genome: From DNA to Protein

An elongating ribosome is bound to appropriate tRNAs in both the A and the P sites and is ready for peptidyl transfer. What happens next?

Which of the following processes takes place in the nucleoli within the eukaryotic nucleus?

Which of the following nucleotides is hydrolyzed in both transcription and in translation elongation?

In the following representation of a single-stranded RNA molecule, the nucleotide residues are drawn as gray circles, while base-pairing interactions between them are indicated by dashed lines. The structure of this RNA molecule has...

For the bacterial transcription machinery, which of the following mRNA sequences would you expect to constitute a potent transcriptional termination signal? Note that the two underlined regions in each sequence are complementary to each other.

Which of the following types of noncoding RNA chiefly functions in the processing and chemical modification of ribosomal RNAs (rRNAs)?

What is the function of the 19S cap in the proteasome complex?

As an mRNA molecule is processed in the nucleus, it loses some proteins and binds to new ones, some of which are used in mRNA surveillance pathways. The presence of which of the following molecules on an mRNA is a signal that the mRNA is still NOT ready for nuclear export?

Which of the following better describes a typical, actively translated mRNA in its journey from the nucleus to the cytosol?

Eukaryotic pre-mRNAs undergo a number of modifications such as capping at the 5' end. A 5' cap...

After the first and before the second chemical step of RNA splicing, the intron of the pre-mRNA...

A primary mRNA transcript with three exons is depicted below. Which of the following mature mRNA products of this transcript is a result of exon skipping?

Each aminoacyl-tRNA synthetase activates a certain amino acid by attaching it to its corresponding tRNA(s) through a high-energy linkage...

How many ATP molecules must be hydrolyzed by the proteasome for the digestion of a protein that has been tagged for degradation with a polyubiquitin chain?

In the following qualitative histogram, which two curves better correspond to human exon and intron length distributions, respectively?

Cells and Genomes

Cell Chemistry and Bioenergetics

Proteins

DNA, Chromosomes, and Genomes

DNA Replication, Repair, and Recombination

Control of Gene Expression

Analyzing Cells, Molecules, and Systems

Visualizing Cells

Membrane Structure

Membrane Transport of Small Molecules and the Electrical Properties of Membranes

Intracellular Compartments and Protein Sorting

Intracellular Membrane Traffic

Energy Conversion: Mitochondria and Chloroplasts

Cell Signaling

The Cytoskeleton

The Cell Cycle

Cell Death

Cell Junctions and the Extracellular Matrix

Cancer

Development of Multicellular Organisms

Stem Cells and Tissue Renewal

Pathogens and Infection

The Innate and Adaptive Immune Systems

Filters