Question 1

When a DNA molecule is described as replicating bidirectionally,that means that it has two:

Accepted Answer

A) chains. 
B) independently replicating segment. 
C) origins. 
D) replication forks. 
E) termination points. 
A) chains. 
B) independently replicating segment. 
C) origins. 
D) replication forks. 
E) termination points.

Question 2

Name the three possible outcomes or consequences (at the DNA level)of a site-specific recombination event.For each of these,explain concisely (in one sentence)how the relative location and orientation of the recombination sites determines the outcome of the recombination event.Do not describe specific examples of site-specific recombination systems.

Accepted Answer

When two sites on a single DNA have the

Question 3

The proofreading function of DNA polymerase involves all of the following except:

Accepted Answer

A) a 3' $\rightarrow$ 5' exonuclease. 
B) base pairing. 
C) detection of mismatched base pairs. 
D) phosphodiester bond hydrolysis. 
E) reversal of the polymerization reaction. 
A) a 3' $\rightarrow$ 5' exonuclease. 
B) base pairing. 
C) detection of mismatched base pairs. 
D) phosphodiester bond hydrolysis. 
E) reversal of the polymerization reaction.

Question 4

An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation rate,because:

Accepted Answer

A) alternative modified nucleotides can be incorporated more readily. 
B) interference from the RecA and SSB proteins hinders the normal replication accuracy. 
C) replication proceeds much faster than normal,resulting in many more mistakes. 
D) the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III. 
E) the DNA polymerases involved lack exonuclease proofreading activities. 
A) alternative modified nucleotides can be incorporated more readily. 
B) interference from the RecA and SSB proteins hinders the normal replication accuracy. 
C) replication proceeds much faster than normal,resulting in many more mistakes. 
D) the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III. 
E) the DNA polymerases involved lack exonuclease proofreading activities.

Question 5

Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.

Accepted Answer

A double strand break is converted to a

Question 6

All known DNA polymerases catalyze synthesis only in the 5' $\rightarrow$ 3' direction.Nevertheless,during semiconservative DNA replication in the cell,they are able to catalyze the synthesis of both daughter chains,which would appear to require synthesis in the 3'$\rightarrow$ 5' direction.Explain the process that occurs in the cell that allows for synthesis of both daughter chains by DNA polymerase.

Accepted Answer

During DNA replication,one strand is syn

Question 7

At replication forks in E.coli:

Accepted Answer

A) DNA helicases make endonucleolytic cuts in DNA. 
B) DNA primers are degraded by exonucleases. 
C) DNA topoisomerases make endonucleolytic cuts in DNA. 
D) RNA primers are removed by primase. 
E) RNA primers are synthesized by primase. 
A) DNA helicases make endonucleolytic cuts in DNA. 
B) DNA primers are degraded by exonucleases. 
C) DNA topoisomerases make endonucleolytic cuts in DNA. 
D) RNA primers are removed by primase. 
E) RNA primers are synthesized by primase.

Question 8

Match between columns
                        Premises: direct chemical reversal of pyrimidine dimer formation
DNA synthesis in gaps
seals nicks
adenine deamination
OS1U1P16S1S1P0-methylguanine
binds to mismatch in DNA
cytosine deamination
base loss
binds to GATC sequences
double-strand break  excision of a lesion-containing oligonucleotide

Accepted Answer

The Answer of mutS-mutL complex and DNA photolyase and ABC is...

Question 9

The DNA below is replicated from left to right.Label the templates for leading strand and lagging strand synthesis.
(5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3')
(3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

Accepted Answer

The polarity of the strands in

Question 10

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:

Accepted Answer

A) coenzyme A. 
B) coenzyme Q. 
C) FADH-. 
D) pyridoxal phosphate (PLP). 
E) thiamine pyrophosphate (TPP). 
A) coenzyme A. 
B) coenzyme Q. 
C) FADH-. 
D) pyridoxal phosphate (PLP). 
E) thiamine pyrophosphate (TPP).

Question 11

Why does DNA damage that causes alkylation of nucleotides sometimes lead to transition mutations?

Accepted Answer

When guanine is alkylated to O⁶-methylgua

Question 12

In homologous recombination in E.coli,the protein that assembles into long,helical filaments that coat a region of DNA is:

Accepted Answer

A) DNA methylase. 
B) DNA polymerase. 
C) histone. 
D) RecA protein. 
E) RecBCD enzyme. 
A) DNA methylase. 
B) DNA polymerase. 
C) histone. 
D) RecA protein. 
E) RecBCD enzyme.

Question 13

Why is the drug acyclovir effective against the herpes simplex virus?

Accepted Answer

Acyclovir is a guanine nucleoside with a

Question 14

What distinguishes the simple from the complex class of bacterial transposon?

Accepted Answer

The simple class called insertion sequen

Question 15

The Meselson-Stahl experiment established that:

Accepted Answer

A) DNA polymerase has a crucial role in DNA synthesis. 
B) DNA synthesis in E.coli proceeds by a conservative mechanism. 
C) DNA synthesis in E.coli proceeds by a semiconservative mechanism. 
D) DNA synthesis requires dATP,dCTP,dGTP,and dTTP. 
E) newly synthesized DNA in E.coli has a different base composition than the preexisting DNA. 
A) DNA polymerase has a crucial role in DNA synthesis. 
B) DNA synthesis in E.coli proceeds by a conservative mechanism. 
C) DNA synthesis in E.coli proceeds by a semiconservative mechanism. 
D) DNA synthesis requires dATP,dCTP,dGTP,and dTTP. 
E) newly synthesized DNA in E.coli has a different base composition than the preexisting DNA.

Question 16

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

Accepted Answer

(1) Homologous chromosomes are aligned.

Question 17

Describe the process of nucleotide-excision repair of lesions like pyrimidine dimers in E.coli.

Accepted Answer

DNA lesions such as pyrimidine dimers ar

Question 18

E.coli DNA polymerase III:

Accepted Answer

A) can initiate replication without a primer. 
B) is efficient at nick translation. 
C) is the principal DNA polymerase in chromosomal DNA replication. 
D) represents over 90% of the DNA polymerase activity in E.coli cells. 
E) requires a free 5'-hydroxyl group as a primer. 
A) can initiate replication without a primer. 
B) is efficient at nick translation. 
C) is the principal DNA polymerase in chromosomal DNA replication. 
D) represents over 90% of the DNA polymerase activity in E.coli cells. 
E) requires a free 5'-hydroxyl group as a primer.

Question 19

Which of the following is not required for elongation during DNA replication in E.coli?

Accepted Answer

A) DnaB (helicase) 
B) DnaG (primase) 
C) DnaC 
D) ($\beta$-sliding clamp) 
E) Clamp loader 
A) DnaB (helicase) 
B) DnaG (primase) 
C) DnaC 
D) ($\beta$-sliding clamp) 
E) Clamp loader

Question 20

Which of the following is not a feature of site-specific recombination?

Accepted Answer

A) A specific recombinase enzyme is required. 
B) The energy of the phosphodiester bond is preserved in covalent enzyme-DNA linkage. 
C) Recombination sites have non-palindromic sequences. 
D) Formation of Holliday intermediates is required. 
E) Insertions or deletions can result from site-specific recombination. 
A) A specific recombinase enzyme is required. 
B) The energy of the phosphodiester bond is preserved in covalent enzyme-DNA linkage. 
C) Recombination sites have non-palindromic sequences. 
D) Formation of Holliday intermediates is required. 
E) Insertions or deletions can result from site-specific recombination.

Exam 25: Dna Metabolism

When a DNA molecule is described as replicating bidirectionally,that means that it has two:

The proofreading function of DNA polymerase involves all of the following except:

An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation rate,because:

Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.

At replication forks in E.coli:

The DNA below is replicated from left to right.Label the templates for leading strand and lagging strand synthesis. (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:

Why does DNA damage that causes alkylation of nucleotides sometimes lead to transition mutations?

In homologous recombination in E.coli,the protein that assembles into long,helical filaments that coat a region of DNA is:

Why is the drug acyclovir effective against the herpes simplex virus?

What distinguishes the simple from the complex class of bacterial transposon?

The Meselson-Stahl experiment established that:

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

Describe the process of nucleotide-excision repair of lesions like pyrimidine dimers in E.coli.

E.coli DNA polymerase III:

Which of the following is not required for elongation during DNA replication in E.coli?

Which of the following is not a feature of site-specific recombination?

The Foundations of Biochemistry

Water

Amino Acids, peptides, and Proteins

The Three-Dimensional Structure of Proteins

Protein Function

Enzymes

Carbohydrates and Glycobiology

Nucleotides and Nucleic Acids

Recombinant Dna Technology

Lipids

Biological Membranes and Transport

Biosignaling

Principles of Bioenergetics

Glycolysis, gluconeogenesis, and the Pentose Phosphate Pathway

Principles of Metabolic Regulation

The Citric Acid Cycle

Fatty Acid Catabolism

Amino Acid Oxidation and the Production of Urea

Oxidative Phosphorylation and Photophosphorylation

Carbohydrate Biosynthesis in Plants and Bacteria

Lipid Biosynthesis

Biosynthesis of Amino Acids, nucleotides, and Related Molecules

Integration and Hormonal Regulation of Mammalian Metabolism

Genes and Chromosomes

Rna Metabolism

Protein Metabolism

Regulation of Gene Expression

Filters