Exam 12: DNA Technology and Genomics

What is the current standard tool used for DNA profiling by forensic scientists?

Which technology is possible to achieve using next-generation or third-generation sequencing?

Approximately what percentage of the human genome is identical to that of a chimpanzee?

Segments of eukaryotic DNA that can move or be copied from one site to another in the genome are called

Which statement about genomics is false?

Which of the following statements regarding repetitive DNA is false?

Use the accompanying figure to answer the following question. The bands in the ladder are in 10-base increments, starting with 10 bases at the bottom and going to 70 bases at the top. CS, crime scene; S1, suspect 1; S2, suspect 2; S3, suspect 3. Which suspect is likely to have committed the crime?

When plasmids are used to produce a desired protein

A vaccine works by

When DNA from two sources is combined into one single piece of DNA, it is known as

A transgenic animal is an animal

Suppose a researcher is interested in using the CRISPR-Cas9 system to knock out the phosphofructokinase gene of a rat skin cell that codes for an enzyme that is critical for glycolysis to occur. The researcher added the Cas9 enzyme to the cell but forgot to add the guide RNA. What result do you think the researcher will observe?

Cystic fibrosis is an autosomal recessive genetic disorder that most severely affects the lungs and respiratory tract. Cystic fibrosis is caused by a mutation in the gene for the protein cystic fibrosis transmembrane regulator (CFTR), which regulates the movement of chloride and sodium ions across epithelial cell membranes. When the CFTR gene is mutated in cystic fibrosis, the defective CFTR protein cannot transport ions properly, which results in too little water drawn across the membrane and the buildup of thick and sticky (viscous) mucus, especially in the airways. This leads to difficulty of breathing, frequent lung infections, and ultimately death. Research has shown that some of the increased thickness and viscosity of the mucus in the respiratory tract is due to the presence of human DNA. If DNA is present in high concentrations in solution, the DNA molecules can get entangled and lead to a thick, viscous solution. To combat this, pharmaceutical companies have developed recombinant forms of the human deoxyribonuclease I (DNase I) protein. DNase I, after being translated and modified with sugar groups, is normally produced in human cells and possibly plays a role in DNA breakdown during apoptosis (programmed cell death). -If you wanted to produce a recombinant form of DNase I, what cell type should you use?

After DNA fragments with matching sticky ends are temporarily joined by complementary base pairing, the union can be made permanent by the "pasting" enzyme

What other enzyme is the Cas9 enzyme most similar to?

The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below. AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?

Which is a transgenic organism?

Genetically modifying ________ cells may directly affect future generations.

The number of proteins in humans

Approximately what percentage of human DNA does not code for proteins?