Question 1

An enzyme that catalyzes the formation of covalent bonds between two DNA fragments,creating a single piece of DNA,is a(n)________.

Accepted Answer

The answer of An enzyme that catalyzes the formation of...

Question 2

In reproductive cloning,if the egg cell was not enucleated before it was fused to the somatic cell,the embryo that developed would have ________ set(s)of chromosomes.

Accepted Answer

A)  1 
B)  2 
C)  3 
D)  4 
A)  1 
B)  2 
C)  3 
D)  4

Question 3

In the following photograph,which letter correctly identifies the inner cell mass?

Accepted Answer

A)  A 
B)  B 
C)  C 
D)  The inner cell mass is not labeled in this picture. 
A)  A 
B)  B 
C)  C 
D)  The inner cell mass is not labeled in this picture.

Question 4

A segment of DNA in a test tube replicates and produces many copies of itself.What was probably in the test tube that enhanced this process?

Accepted Answer

A)  a ligase 
B)  a restriction enzyme 
C)  DNA polymerase 
D)  an electric current 
A)  a ligase 
B)  a restriction enzyme 
C)  DNA polymerase 
D)  an electric current

Question 5

Examine the following image of a gel produced by the electrophoresis of DNA.The smallest fragment on the gel is the one indicated by the star.

Accepted Answer

A) True 
 B)False

Question 6

Researchers at Cedars-Sinai Medical Center tested gene therapy on only one side of the Parkinson's disease patients' brains because the disease affects only one side of the brain.

Accepted Answer

A) True 
 B)False

Question 7

Reproductively cloned animals are the same age as their parent.

Accepted Answer

A) True 
 B)False

Question 8

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

Accepted Answer

A)  One; SmaI does not cut this piece of DNA. 
B)  Two; SmaI cuts this piece of DNA once. 
C)  Two; SmaI cuts this piece of DNA twice. 
D)  Four; SmaI cuts this piece of DNA four times. 
A)  One; SmaI does not cut this piece of DNA. 
B)  Two; SmaI cuts this piece of DNA once. 
C)  Two; SmaI cuts this piece of DNA twice. 
D)  Four; SmaI cuts this piece of DNA four times.

Question 9

Multipotency and unipotency develop when specific genes are deleted from adult stem cells.

Accepted Answer

A) True 
 B)False

Question 10

A sample of the same DNA is placed into each of two test tubes.Each tube is treated with a restriction enzyme,and the resulting fragments are separated by gel electrophoresis,producing the gel shown in the following figure.Which of the following explains why the pattern of DNA fragments differs in these two samples?

Accepted Answer

A)  Different restriction enzymes must have been used in the different tubes. 
B)  One tube was heated, but the other tube was not. 
C)  Ligase was added to one of the tubes but not the other. 
D)  The restriction enzyme added to the tubes cut DNA at more than one sequence. 
A)  Different restriction enzymes must have been used in the different tubes. 
B)  One tube was heated, but the other tube was not. 
C)  Ligase was added to one of the tubes but not the other. 
D)  The restriction enzyme added to the tubes cut DNA at more than one sequence.

Question 11

To make recombinant DNA,

Accepted Answer

A)  two nonhomologous chromosomes are induced to undergo crossing-over during meiosis. 
B)  the entire genome of one organism is fused to a plasmid. 
C)  pieces of DNA from different organisms are cut with restriction enzymes and then joined together. 
D)  DNA polymerase is used to make multiple copies of the DNA sequences of two organisms at the same time. 
A)  two nonhomologous chromosomes are induced to undergo crossing-over during meiosis. 
B)  the entire genome of one organism is fused to a plasmid. 
C)  pieces of DNA from different organisms are cut with restriction enzymes and then joined together. 
D)  DNA polymerase is used to make multiple copies of the DNA sequences of two organisms at the same time.

Question 12

A vector is used to "ferry" DNA from one organism into another.In gene therapy,what acts as the vector?

Accepted Answer

A)  a virus 
B)  a plasmid 
C)  a restriction enzyme 
D)  a genetically modified organism 
A)  a virus 
B)  a plasmid 
C)  a restriction enzyme 
D)  a genetically modified organism

Question 13

The bacterium shown in the following image is a genetically modified organism.

Accepted Answer

A) True 
 B)False

Question 14

Human gene therapy involves

Accepted Answer

A)  introducing a functioning copy of the defective gene into the patient. 
B)  using plasmids to carry genes that will break down a specific harmful gene in a patient. 
C)  inserting genes from other organisms into the human genome. 
D)  using PCR to produce large amounts of normal DNA that can be injected into a patient. 
A)  introducing a functioning copy of the defective gene into the patient. 
B)  using plasmids to carry genes that will break down a specific harmful gene in a patient. 
C)  inserting genes from other organisms into the human genome. 
D)  using PCR to produce large amounts of normal DNA that can be injected into a patient.

Question 15

Gene therapy is now effective in treating complex inherited disorders that involve multiple genes.

Accepted Answer

A) True 
 B)False

Question 16

Seventy-five percent of processed foods found in U.S.grocery stores may contain ingredients from genetically engineered plants.

Accepted Answer

A) True 
 B)False

Question 17

In reproductive cloning of mammals,if the egg cell is not enucleated before being fused to the donated somatic cell,the embryo will develop normally,but it will have two genetic parents.

Accepted Answer

A) True 
 B)False

Question 18

Genetically modified organisms are also called________ organisms.

Accepted Answer

The answer of Genetically modified organisms are also called________ organisms....

Question 19

DNA fingerprinting can prove guilt without fail.

Accepted Answer

A) True 
 B)False

Question 20

In the X-SCID gene therapy trial in which some of the patients developed leukemia,the "good copy" of the gene probably inserted near a(n)________ gene.

Accepted Answer

A)  short tandem repeat 
B)  immune system 
C)  housekeeping 
D)  tumor promoter 
A)  short tandem repeat 
B)  immune system 
C)  housekeeping 
D)  tumor promoter

Exam 13: DNA Technology

An enzyme that catalyzes the formation of covalent bonds between two DNA fragments,creating a single piece of DNA,is a(n)________.

In reproductive cloning,if the egg cell was not enucleated before it was fused to the somatic cell,the embryo that developed would have ________ set(s)of chromosomes.

In the following photograph,which letter correctly identifies the inner cell mass?

A segment of DNA in a test tube replicates and produces many copies of itself.What was probably in the test tube that enhanced this process?

Examine the following image of a gel produced by the electrophoresis of DNA.The smallest fragment on the gel is the one indicated by the star.

Researchers at Cedars-Sinai Medical Center tested gene therapy on only one side of the Parkinson's disease patients' brains because the disease affects only one side of the brain.

Reproductively cloned animals are the same age as their parent.

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG.How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

Multipotency and unipotency develop when specific genes are deleted from adult stem cells.

To make recombinant DNA,

A vector is used to "ferry" DNA from one organism into another.In gene therapy,what acts as the vector?

The bacterium shown in the following image is a genetically modified organism.

Human gene therapy involves

Gene therapy is now effective in treating complex inherited disorders that involve multiple genes.

Seventy-five percent of processed foods found in U.S.grocery stores may contain ingredients from genetically engineered plants.

In reproductive cloning of mammals,if the egg cell is not enucleated before being fused to the donated somatic cell,the embryo will develop normally,but it will have two genetic parents.

Genetically modified organisms are also called________ organisms.

DNA fingerprinting can prove guilt without fail.

In the X-SCID gene therapy trial in which some of the patients developed leukemia,the "good copy" of the gene probably inserted near a(n)________ gene.

The Nature of Science and the Characteristics of Life

The Chemistry of Life

Cell Structure and Internal Compartments

Cell Membranes, Transport, and Communication

Energy, Metabolism, and Enzymes

Photo Synthesis and Cellular Respiration

Cell Division

Cancer and Human Health

Patterns of Inheritance

Chromosomes and Human Genetics

DNA and Genes

From Gene to Protein

How Evolution Works

The Origin of Species

The Evolution of Biodiversity

Biological Diversity, Bacteria, and Archaea

Protista, Plantae, and Fungi

Animalia

The Biosphere

Growth of Populations

Animal Behavior

Ecological Communities

Ecosystems

Global Change

Filters