Question 1

If you knew the sequence of a gene in one organism, how could you determine if another organism had a similar gene?

Accepted Answer

A) treat the genomes of both organisms with the same restriction enzyme and compare the patterns of the bands produced with gel electrophoresis 
B) insert the known gene into a vector and use the vector to insert the known gene into the other organism 
C) create labeled DNA probes from the known gene and use them to search the genome of the other organism 
D) create a hybrid of the two organisms by breeding them and check for mutations 
A) treat the genomes of both organisms with the same restriction enzyme and compare the patterns of the bands produced with gel electrophoresis 
B) insert the known gene into a vector and use the vector to insert the known gene into the other organism 
C) create labeled DNA probes from the known gene and use them to search the genome of the other organism 
D) create a hybrid of the two organisms by breeding them and check for mutations

Question 2

DNA from one organism will not bond to DNA from another organism.

Accepted Answer

A) True 
 B)False

Question 3

In DNA fingerprinting, which regions of DNA would provide the strongest evidence of a genetic relationship?

Accepted Answer

A) regions with noncoding and spacer DNA 
B) regions that contain the genes for hemoglobin 
C) regions that might contain genes related to personality disorders 
D) regions that can be easily fragmented 
A) regions with noncoding and spacer DNA 
B) regions that contain the genes for hemoglobin 
C) regions that might contain genes related to personality disorders 
D) regions that can be easily fragmented

Question 4

The most efficient method of determining the DNA sequence of a gene is to

Accepted Answer

A) insert the ligase gene. 
B) expose it to radioactivity. 
C) use an automated sequencing machine. 
D) hand count the base pairs. 
A) insert the ligase gene. 
B) expose it to radioactivity. 
C) use an automated sequencing machine. 
D) hand count the base pairs.

Question 5

When the FBI investigates crimes with DNA evidence, they compare 13 different noncoding regions of the human genome between the DNA evidence and the suspect. Why is it important to look at so many regions?

Accepted Answer

A) Repeating the test in different areas of the DNA ensures that the investigator did not make any mistakes in determining the DNA sequence. 
B) Most regions of the human genome are identical, so you have to look in many locations to make sure you find a region that shows differences. 
C) The more regions of the DNA you examine, the less likely you are to run into a coincidental similarity between DNA sequences. 
D) Restriction enzymes only work in these 13 regions of the human genome. 
A) Repeating the test in different areas of the DNA ensures that the investigator did not make any mistakes in determining the DNA sequence. 
B) Most regions of the human genome are identical, so you have to look in many locations to make sure you find a region that shows differences. 
C) The more regions of the DNA you examine, the less likely you are to run into a coincidental similarity between DNA sequences. 
D) Restriction enzymes only work in these 13 regions of the human genome.

Question 6

A sample of the same DNA is placed into each of two test tubes. Each tube is treated with a restriction enzyme and the resulting fragments are separated by gel electrophoresis producing the gel shown in the figure below. Which of the following explains why the pattern of DNA fragments differs in these two samples?

Accepted Answer

A) Different restriction enzymes must have been used in the different tubes. 
B) One tube was heated, but the other tube was not. 
C) Ligase was added to one of the tubes, but not the other. 
D) The restriction enzyme added to the tubes cut DNA at more than one sequence. 
A) Different restriction enzymes must have been used in the different tubes. 
B) One tube was heated, but the other tube was not. 
C) Ligase was added to one of the tubes, but not the other. 
D) The restriction enzyme added to the tubes cut DNA at more than one sequence.

Question 7

Interference RNA (RNAᵢ)functions by

Accepted Answer

A) slowing or preventing the formation of ribosomes in cells infected with a virus. 
B) preventing the replication of viral DNA. 
C) producing restriction enzymes that degrade viral DNA. 
D) "silencing" viral genes by binding to complementary sequences. 
A) slowing or preventing the formation of ribosomes in cells infected with a virus. 
B) preventing the replication of viral DNA. 
C) producing restriction enzymes that degrade viral DNA. 
D) "silencing" viral genes by binding to complementary sequences.

Question 8

In research, restriction enzymes are used to

Accepted Answer

A) stop replication of DNA at a specific base during DNA sequencing. 
B) cut DNA molecules into pieces that can be used to create recombinant DNA. 
C) measure the relative amounts of each base in a DNA molecule. 
D) join two fragments of DNA together to form a molecule of recombinant DNA. 
A) stop replication of DNA at a specific base during DNA sequencing. 
B) cut DNA molecules into pieces that can be used to create recombinant DNA. 
C) measure the relative amounts of each base in a DNA molecule. 
D) join two fragments of DNA together to form a molecule of recombinant DNA.

Question 9

A detective finds a miniscule spot of blood on a murder suspect's shirt. What method would she expect the police lab to use to get enough DNA from the blood droplet to perform DNA fingerprinting?

Accepted Answer

A) inserting the blood's DNA into viral DNA 
B) polymerase chain reaction (PCR) 
C) inserting the sample's DNA into a plasmid 
D) using ligases to bond the DNA fragments together for sequencing 
A) inserting the blood's DNA into viral DNA 
B) polymerase chain reaction (PCR) 
C) inserting the sample's DNA into a plasmid 
D) using ligases to bond the DNA fragments together for sequencing

Question 10

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC
TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

Accepted Answer

A) One; SmaI does not cut this piece of DNA. 
B) Two; SmaI cuts this piece of DNA once. 
C) Two; SmaI cuts this piece of DNA twice. 
D) Four; SmaI cuts this piece of DNA four times. 
A) One; SmaI does not cut this piece of DNA. 
B) Two; SmaI cuts this piece of DNA once. 
C) Two; SmaI cuts this piece of DNA twice. 
D) Four; SmaI cuts this piece of DNA four times.

Question 11

A segment of DNA in a test tube replicates and produces many copies of itself. What was probably in the test tube that enhanced this process?

Accepted Answer

A) a ligase 
B) a restriction enzyme 
C) DNA polymerase 
D) an electric current 
A) a ligase 
B) a restriction enzyme 
C) DNA polymerase 
D) an electric current

Question 12

Cloning is useful because it

Accepted Answer

A) repairs broken DNA. 
B) mixes the DNA from two different organisms. 
C) produces many copies of recombinant DNA. 
D) determines the base sequence of a gene. 
A) repairs broken DNA. 
B) mixes the DNA from two different organisms. 
C) produces many copies of recombinant DNA. 
D) determines the base sequence of a gene.

Question 13

DNA extraction

Accepted Answer

A) uses restriction enzymes to prevent chromosomes from unraveling. 
B) can only occur when the gene of interest has been amplified by PCR. 
C) occurs only in prokaryotic cells because they lack a protective nucleus. 
D) requires that all non-DNA organic compounds be removed with chemicals. 
A) uses restriction enzymes to prevent chromosomes from unraveling. 
B) can only occur when the gene of interest has been amplified by PCR. 
C) occurs only in prokaryotic cells because they lack a protective nucleus. 
D) requires that all non-DNA organic compounds be removed with chemicals.

Question 14

The nuclear DNA of the embryo that results from the process shown in the diagram below

Accepted Answer

A) is identical to the nuclear DNA of the Scottish Blackface sheep. 
B) is identical to the nuclear DNA of the Finn Dorset sheep. 
C) is a unique mix of the nuclear DNA from both of the pictured sheep. 
D) contains one full set of chromosomes from each of the pictured sheep. 
A) is identical to the nuclear DNA of the Scottish Blackface sheep. 
B) is identical to the nuclear DNA of the Finn Dorset sheep. 
C) is a unique mix of the nuclear DNA from both of the pictured sheep. 
D) contains one full set of chromosomes from each of the pictured sheep.

Question 15

DNA moves toward the ____________________ charged end of an electrical field during gel electrophoresis.

Accepted Answer

The answer of DNA moves toward the ____________________ charged end...

Question 16

Human gene therapy involves

Accepted Answer

A) correcting genetic disorders by modifying the genes that cause them. 
B) using plasmids to carry genes that will break down a specific harmful gene in a patient. 
C) inserting genes from other organisms into the human genome. 
D) using PCR to produce large amounts of normal DNA that can be injected into a patient. 
A) correcting genetic disorders by modifying the genes that cause them. 
B) using plasmids to carry genes that will break down a specific harmful gene in a patient. 
C) inserting genes from other organisms into the human genome. 
D) using PCR to produce large amounts of normal DNA that can be injected into a patient.

Question 17

If you wanted to know what proteins were produced in a bacterium in response to the presence of a particular chemical, you would look to scientists in the field of ____________________.

Accepted Answer

The answer of If you wanted to know what proteins...

Question 18

During ____________________ cloning, the nucleus of an egg cell is replaced with the nucleus of a somatic cell from the individual being cloned.

Accepted Answer

The answer of During ____________________ cloning, the nucleus of an...

Question 19

A restriction enzyme cuts DNA into fragments

Accepted Answer

A) whenever the correct ligase is present. 
B) only in laboratory conditions. 
C) only in the organism that produces it. 
D) when mixed with the DNA that contains the target DNA sequence. 
A) whenever the correct ligase is present. 
B) only in laboratory conditions. 
C) only in the organism that produces it. 
D) when mixed with the DNA that contains the target DNA sequence.

Question 20

The polymerase chain reaction (PCR)technique could be developed only after the discovery of bacterial enzymes that were able to withstand high temperatures. Why was it necessary to use such enzymes?

Accepted Answer

A) Only bacterial DNA can be copied using the PCR method, so bacterial enzymes were necessary. 
B) Bacterial enzymes can move through the gel only during PCR electrophoresis. 
C) DNA can be cut into fragments only at high temperatures. 
D) The temperature required to separate DNA strands during PCR degrades most normal enzymes. 
A) Only bacterial DNA can be copied using the PCR method, so bacterial enzymes were necessary. 
B) Bacterial enzymes can move through the gel only during PCR electrophoresis. 
C) DNA can be cut into fragments only at high temperatures. 
D) The temperature required to separate DNA strands during PCR degrades most normal enzymes.

Exam 16: Dna Technology

If you knew the sequence of a gene in one organism, how could you determine if another organism had a similar gene?

DNA from one organism will not bond to DNA from another organism.

In DNA fingerprinting, which regions of DNA would provide the strongest evidence of a genetic relationship?

The most efficient method of determining the DNA sequence of a gene is to

When the FBI investigates crimes with DNA evidence, they compare 13 different noncoding regions of the human genome between the DNA evidence and the suspect. Why is it important to look at so many regions?

Interference RNA (RNAᵢ)functions by

In research, restriction enzymes are used to

A detective finds a miniscule spot of blood on a murder suspect's shirt. What method would she expect the police lab to use to get enough DNA from the blood droplet to perform DNA fingerprinting?

The restriction enzyme SmaI cuts DNA between the last C and the first G in the sequence CCCGGG. How many fragments of DNA would be produced if the following sequence were treated with SmaI? AGTTTCGAGAGCGGATGCCCGGGCCACGGGGATTATACGCAGAGTCCAC TCAAAGCTCTCGCCTACGGGCCCGGTGCCCCTAATATGCGTCTCAGGTG

A segment of DNA in a test tube replicates and produces many copies of itself. What was probably in the test tube that enhanced this process?

Cloning is useful because it

DNA extraction

The nuclear DNA of the embryo that results from the process shown in the diagram below

DNA moves toward the ____________________ charged end of an electrical field during gel electrophoresis.

Human gene therapy involves

If you wanted to know what proteins were produced in a bacterium in response to the presence of a particular chemical, you would look to scientists in the field of ____________________.

During ____________________ cloning, the nucleus of an egg cell is replaced with the nucleus of a somatic cell from the individual being cloned.

A restriction enzyme cuts DNA into fragments

The polymerase chain reaction (PCR)technique could be developed only after the discovery of bacterial enzymes that were able to withstand high temperatures. Why was it necessary to use such enzymes?

The Nature of Science and the Characteristics of Life

Biological Diversity, Bacteria, and Archaea

Protista, Plantae, and Fungi

Animalia

The Chemistry of Life

Cell Structure and Internal Compartments

Cell Membranes, Transport, and Communication

Energy, Metabolism, and Enzymes

Photosynthesis and Cellular Respiration

Cell Division

Stem Cells, Cancer, and Human Health

Patterns of Inheritance

Chromosomes and Human Genetics

Dna and Genes

From Gene to Protein

How Evolution Works

Evolution of Populations

Speciation and the Origins of Biological Diversity

The Evolutionary History of Life

The Biosphere

Growth of Populations

Ecological Communities

Ecosystems

Global Change

Internal Organization and Homeostasis

Nutrition and Digestion

Circulation and Gas Exchange

Animal Hormones

Nervous and Sensory Systems

Skeletons, Muscles, and Movement

Defenses Against Disease

Reproduction and Development

Animal Behavior

Plant Structure, Nutrition, and Transport

Plant Growth and Reproduction

Filters