Question 1

When one base is changed to another at a single position in the DNA sequence of a gene,the result is a(n)________ mutation.

Accepted Answer

A)  insertion 
B)  deletion 
C)  frameshift 
D)  substitution 
A)  insertion 
B)  deletion 
C)  frameshift 
D)  substitution

Question 2

If a eukaryotic protein is to function properly,the initial mRNA carrying the code for its structure must be processed to remove its ________.Then,before translation occurs,the joining together of the remaining sequences of mRNA,the ________,must be accomplished.

Accepted Answer

The answer of If a eukaryotic protein is to function...

Question 3

DNA molecules are double-stranded,whereas most RNA molecules are single-stranded.Which of the following choices is the most likely reason that RNA does NOT need to be double-stranded?

Accepted Answer

A)  DNA reproduces itself directly, whereas RNA does not. 
B)  RNA reproduces itself directly, whereas DNA does not. 
C)  DNA undergoes translation that requires the use of both strands at the same time. 
D)  RNA undergoes transcription that can only read one strand at a time. 
A)  DNA reproduces itself directly, whereas RNA does not. 
B)  RNA reproduces itself directly, whereas DNA does not. 
C)  DNA undergoes translation that requires the use of both strands at the same time. 
D)  RNA undergoes transcription that can only read one strand at a time.

Question 4

Which of the following is NOT a feature of the genetic code?

Accepted Answer

A)  Every individual has a different genetic code. 
B)  Each codon in the genetic code specifies only one amino acid. 
C)  The genetic code is redundant. 
D)  The same genetic code can be applied to virtually every organism on Earth. 
A)  Every individual has a different genetic code. 
B)  Each codon in the genetic code specifies only one amino acid. 
C)  The genetic code is redundant. 
D)  The same genetic code can be applied to virtually every organism on Earth.

Question 5

In tRNA,an amino acid is covalently bonded to an anticodon.

Accepted Answer

A) True 
 B)False

Question 6

The lac repressor has been mutated so that its binding site for lactose has been altered to the extent that it is unable to bind to lactose.What is the likely effect of this mutation on the lac operon?

Accepted Answer

A)  The repressor will be unable to bind to the operator, and the operon will thus be turned on. 
B)  The repressor will bind to the operator and suppress transcription of the operon despite the presence of lactose. 
C)  The lac operon will be degraded by the altered repressor. 
D)  The repressor will bind to the operator and enhance the ability of RNA polymerase to bind there. 
A)  The repressor will be unable to bind to the operator, and the operon will thus be turned on. 
B)  The repressor will bind to the operator and suppress transcription of the operon despite the presence of lactose. 
C)  The lac operon will be degraded by the altered repressor. 
D)  The repressor will bind to the operator and enhance the ability of RNA polymerase to bind there.

Question 7

Using the following chart,which chain of amino acids would be produced by the entire sequence UGUACGAUAGGCUAG?

Accepted Answer

A)  ACAUGCUAUAUCCCG 
B)  ACATGCTATATCCCG 
C)  cysteine-threonine-isoleucine-glycine 
D)  cysteine-threonine-isoleucine-glycine-stop 
A)  ACAUGCUAUAUCCCG 
B)  ACATGCTATATCCCG 
C)  cysteine-threonine-isoleucine-glycine 
D)  cysteine-threonine-isoleucine-glycine-stop

Question 8

Which of the following is NOT a mechanism used by cells to reduce gene expression?

Accepted Answer

A)  looser packing of DNA 
B)  a specific increase in mRNA breakdown 
C)  modification of proteins before their translation 
D)  stabilization of a protein so that its "shelf-life" is increased 
A)  looser packing of DNA 
B)  a specific increase in mRNA breakdown 
C)  modification of proteins before their translation 
D)  stabilization of a protein so that its "shelf-life" is increased

Question 9

Changing even a few bases in a molecule of DNA always adversely affects the protein product.

Accepted Answer

A) True 
 B)False

Question 10

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

Accepted Answer

A)  tyrosine-tyrosine-alanine 
B)  tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine 
C)  methionine-proline-glutamate 
D)  methionine-proline-glutamate-isoleucine-alanine 
A)  tyrosine-tyrosine-alanine 
B)  tyrosine-tyrosine-alanine-stop-valine-asparagine-cysteine 
C)  methionine-proline-glutamate 
D)  methionine-proline-glutamate-isoleucine-alanine

Question 11

During RNA splicing

Accepted Answer

A)  introns are removed from RNA, and the remaining exons are connected to form a mature mRNA. 
B)  an RNA molecule is cut up into many small pieces and each piece forms a single mRNA. 
C)  exons are removed from RNA and the remaining introns are fused to form a single mRNA. 
D)  RNA is used to remove mutations from essential genes. 
A)  introns are removed from RNA, and the remaining exons are connected to form a mature mRNA. 
B)  an RNA molecule is cut up into many small pieces and each piece forms a single mRNA. 
C)  exons are removed from RNA and the remaining introns are fused to form a single mRNA. 
D)  RNA is used to remove mutations from essential genes.

Question 12

Each tRNA molecule has a site at one end that ________ and a site at the other end that ________.

Accepted Answer

A)  acts as a promoter; acts as a terminator 
B)  binds to a codon; binds to an anticodon 
C)  binds to an amino acid; binds to a promoter 
D)  binds to an amino acid; binds to a codon 
A)  acts as a promoter; acts as a terminator 
B)  binds to a codon; binds to an anticodon 
C)  binds to an amino acid; binds to a promoter 
D)  binds to an amino acid; binds to a codon

Question 13

The series of bases in mRNA that can specify a single amino acid is called a(n)________.

Accepted Answer

The answer of The series of bases in mRNA that...

Question 14

It is possible for a mutation to occur and yet not alter the end product of translation if

Accepted Answer

A)  the RNA polymerase skips over the mutated area. 
B)  the new codon encodes the same amino acid. 
C)  a deletion mutation removes the entire codon. 
D)  the mutation affects the active site of the protein product. 
A)  the RNA polymerase skips over the mutated area. 
B)  the new codon encodes the same amino acid. 
C)  a deletion mutation removes the entire codon. 
D)  the mutation affects the active site of the protein product.

Question 15

Which of the following is the best and most complete description of the function of genes?

Accepted Answer

A)  They control the production of enzymes. 
B)  They control the production of structural proteins. 
C)  They control the production of all proteins. 
D)  They control the production of amino acids. 
A)  They control the production of enzymes. 
B)  They control the production of structural proteins. 
C)  They control the production of all proteins. 
D)  They control the production of amino acids.

Question 16

The RNA molecule in the following figure could have been translated directly from the DNA molecule shown in this figure.

Accepted Answer

A) True 
 B)False

Question 17

Which molecules are involved in translation?

Accepted Answer

A)  DNA and RNA 
B)  mDNA, tDNA, and rDNA 
C)  mRNA, tRNA, and rRNA 
D)  proteins, amino acids, and DNA 
A)  DNA and RNA 
B)  mDNA, tDNA, and rDNA 
C)  mRNA, tRNA, and rRNA 
D)  proteins, amino acids, and DNA

Question 18

The three-dimensional structure of the protein encoded by a single mRNA molecule varies,but whatever the shape,the overall function of that protein does not change.

Accepted Answer

A) True 
 B)False

Question 19

The first amino acid in most proteins is methionine.

Accepted Answer

A) True 
 B)False

Question 20

As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

Accepted Answer

A)  promoter. 
B)  intron. 
C)  start codon. 
D)  anticodon. 
A)  promoter. 
B)  intron. 
C)  start codon. 
D)  anticodon.

Exam 12: From Gene to Protein

When one base is changed to another at a single position in the DNA sequence of a gene,the result is a(n)________ mutation.

If a eukaryotic protein is to function properly,the initial mRNA carrying the code for its structure must be processed to remove its ________.Then,before translation occurs,the joining together of the remaining sequences of mRNA,the ________,must be accomplished.

DNA molecules are double-stranded,whereas most RNA molecules are single-stranded.Which of the following choices is the most likely reason that RNA does NOT need to be double-stranded?

Which of the following is NOT a feature of the genetic code?

In tRNA,an amino acid is covalently bonded to an anticodon.

The lac repressor has been mutated so that its binding site for lactose has been altered to the extent that it is unable to bind to lactose.What is the likely effect of this mutation on the lac operon?

Using the following chart,which chain of amino acids would be produced by the entire sequence UGUACGAUAGGCUAG?

Which of the following is NOT a mechanism used by cells to reduce gene expression?

Changing even a few bases in a molecule of DNA always adversely affects the protein product.

Using the following chart,which chain of amino acids would be produced by the sequence of this very short,complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

During RNA splicing

Each tRNA molecule has a site at one end that ________ and a site at the other end that ________.

The series of bases in mRNA that can specify a single amino acid is called a(n)________.

It is possible for a mutation to occur and yet not alter the end product of translation if

Which of the following is the best and most complete description of the function of genes?

The RNA molecule in the following figure could have been translated directly from the DNA molecule shown in this figure.

Which molecules are involved in translation?

The three-dimensional structure of the protein encoded by a single mRNA molecule varies,but whatever the shape,the overall function of that protein does not change.

The first amino acid in most proteins is methionine.

As transcription begins,RNA polymerase binds to a segment of a gene called a(n)

The Nature of Science and the Characteristics of Life

The Chemistry of Life

Cell Structure and Internal Compartments

Cell Membranes, Transport, and Communication

Energy, Metabolism, and Enzymes

Photo Synthesis and Cellular Respiration

Cell Division

Cancer and Human Health

Patterns of Inheritance

Chromosomes and Human Genetics

DNA and Genes

DNA Technology

How Evolution Works

The Origin of Species

The Evolution of Biodiversity

Biological Diversity, Bacteria, and Archaea

Protista, Plantae, and Fungi

Animalia

The Biosphere

Growth of Populations

Animal Behavior

Ecological Communities

Ecosystems

Global Change

Filters

If a eukaryotic protein is to function properly,the initial mRNA carrying the code for its structure must be processed to remove its .Then,before translation occurs,the joining together of the remaining sequences of mRNA,the ,must be accomplished.

Each tRNA molecule has a site at one end that and a site at the other end that .