Question 1

Many antibiotics cause mispairing between codons and anticodons. What fatal effect would this mispairing have on the cell?

Accepted Answer

defective

Question 2

_________help control ribosome formation and binding of the initiator tRNA.

Accepted Answer

Initiation

Question 3

How many different aminoacyl- tRNA synthetases can be found in a given organism's cells?

Accepted Answer

A)  At least 20, or more depending on the organism 
B)  16 
C)  61 
D)  20 
E)  The number varies greatly depending on the organisms type. 
A)  At least 20, or more depending on the organism 
B)  16 
C)  61 
D)  20 
E)  The number varies greatly depending on the organisms type.

Question 4

What is the cellular location of the stages of translation in bacteria and eukaryotes?

Accepted Answer

A)  cytosol for bacteria and eukaryotes 
B)  membrane for bacteria and cytosol and rough ER for eukaryotes 
C)  cytosol for bacteria and cytosol, mitochondrion, and plastid for eukaryotes 
D)  nucleoid for bacteria and rough ER for eukaryotes 
E)  cytosol for bacteria and nucleus for eukaryotes 
A)  cytosol for bacteria and eukaryotes 
B)  membrane for bacteria and cytosol and rough ER for eukaryotes 
C)  cytosol for bacteria and cytosol, mitochondrion, and plastid for eukaryotes 
D)  nucleoid for bacteria and rough ER for eukaryotes 
E)  cytosol for bacteria and nucleus for eukaryotes

Question 5

A signal sequence at the N terminus of newly synthesized proteins will direct the protein to the_______ for protein packaging.

Accepted Answer

endoplasmi

Question 6

Sidney Brenner demonstrated that the triplet code is, in fact, nonoverlapping. Assuming a nonoverlapping code, how many COMPLETE codons would the following sequence encode before encountering a stop codon? 5' - AUGCGAUUAUAGUGC - 3'

Accepted Answer

The answer of Sidney Brenner demonstrated that the triplet code...

Question 7

Which of these choices represents one possible corresponding mRNA sequence that can be transcrib from the following DNA template? 
5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3'

Accepted Answer

A)  5' - ATG CGA TTT GGG TGC TAG - 3' 
B)  5' - AUG CGA UUU GGG UGC UAG - 3' 
C)  5' - AUG CGA UUU GGG UGC - 3' 
D)  3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5' 
E)  5' - CTA GCA CCC AAA TCG CAT TAG - 3' 
A)  5' - ATG CGA TTT GGG TGC TAG - 3' 
B)  5' - AUG CGA UUU GGG UGC UAG - 3' 
C)  5' - AUG CGA UUU GGG UGC - 3' 
D)  3' - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5' 
E)  5' - CTA GCA CCC AAA TCG CAT TAG - 3'

Question 8

During elongation, the charged tRNA is recruited to which location on the ribosome?

Accepted Answer

The answer of During elongation, the charged tRNA is recruited...

Question 9

Ribosomal subunits are measured in which units, which describe the speed of sedimentation of a substance during centrifugation?

Accepted Answer

The answer of Ribosomal subunits are measured in which units,...

Question 10

Describe the technique of two- dimensional gel electrophoresis. What are the two dimensions referring to? How is this technique different from conventional gel electrophoresis, and when would it be used?

Accepted Answer

In two- dimensional gel electrophoresis,

Question 11

A portion of mRNA attached to a ribosome reads: 
5' GACCAUUUUUGA 3'
In the polypeptide produced, what amino acid will be attached to the amino group of the histidine encoded by this mRNA?

Accepted Answer

A)  aspartic acid 
B)  proline 
C)  tyrosine 
D)  phenylalanine 
E)  serine 
A)  aspartic acid 
B)  proline 
C)  tyrosine 
D)  phenylalanine 
E)  serine

Question 12

A mutagen has introduced a frame- shift mutation by adding one nucleotide base. Which of the following could be a reversion mutation for this particular mutant?

Accepted Answer

A)  adding 1 base only 
B)  deleting 1 base or adding 1 base 
C)  deleting 1 base or adding 3 bases 
D)  deleting 2 bases only 
E)  deleting 1 base or adding 2 bases 
A)  adding 1 base only 
B)  deleting 1 base or adding 1 base 
C)  deleting 1 base or adding 3 bases 
D)  deleting 2 bases only 
E)  deleting 1 base or adding 2 bases

Question 13

Binding of what protein initiates translation- termination events that result in polypeptide release and dissociation of ribosomal subunits?

Accepted Answer

The answer of Binding of what protein initiates translation- termination...

Question 14

What is necessary for a eukaryotic RNA to be recognized and bound by the small subunit of the ribosome?

Accepted Answer

A)  Sufficiently large 5' UTR for ribosome scanning. 
B)  Presence of an AUG start codon near the 5' end of the mRNA. 
C)  Formation of the pre- initiation complex before ribosome binding. 
D)  Presence of 5' methyl- G cap on the mRNA. 
E)  Formation of the initiation complex before ribosome binding. 
A)  Sufficiently large 5' UTR for ribosome scanning. 
B)  Presence of an AUG start codon near the 5' end of the mRNA. 
C)  Formation of the pre- initiation complex before ribosome binding. 
D)  Presence of 5' methyl- G cap on the mRNA. 
E)  Formation of the initiation complex before ribosome binding.

Question 15

If you are designing an antibiotic that inhibits peptide bond formation, what enzyme would you target?

Accepted Answer

peptidyl t

Question 16

During translation initiation in bacteria, the amino acid on the initiator tRNA is______ .

Accepted Answer

A)  N- formylmethionine (fMet) 
B)  IF- 1 
C)  methionine (Met) 
D)  added using ATP as the energy source 
E)  acetylated 
A)  N- formylmethionine (fMet) 
B)  IF- 1 
C)  methionine (Met) 
D)  added using ATP as the energy source 
E)  acetylated

Question 17

A portion of an mRNA attached to a ribosome reads:
 5' GACCAUUUUUGA 3'
If a tRNA with a Phenylalanine amino acid attached is in the P site of the ribosome, an empty tRNA present in the E site that delivered which amino acid?

Accepted Answer

A)  serine 
B)  proline 
C)  aspartic acid 
D)  tyrosine 
E)  histidine 
A)  serine 
B)  proline 
C)  aspartic acid 
D)  tyrosine 
E)  histidine

Question 18

How does the eukaryotic initiation complex locate the correct start codon?

Accepted Answer

A)  The initiation complex moves the small ribosomal subunit through the 5' UTR, scanning for the start AUG. 
B)  The correct start codon is the first ATG encountered downstream of the Kozak sequence. 
C)  The pre- initiation complex moves the ribosome through the 3' UTR, scanning for the Kozak sequence. 
D)  The correct start codon is the formyl- ATG, which will encode for fMet in the protein. 
E)  The true start codon is the first ATG encountered downstream of the Shine- Dalgarno sequence. 
A)  The initiation complex moves the small ribosomal subunit through the 5' UTR, scanning for the start AUG. 
B)  The correct start codon is the first ATG encountered downstream of the Kozak sequence. 
C)  The pre- initiation complex moves the ribosome through the 3' UTR, scanning for the Kozak sequence. 
D)  The correct start codon is the formyl- ATG, which will encode for fMet in the protein. 
E)  The true start codon is the first ATG encountered downstream of the Shine- Dalgarno sequence.

Question 19

If the first nucleotide in a codon is mutated to a different nucleotide, what would be the effect on the encoded protein?

Accepted Answer

A)  A missense mutation from one encoded amino acid changing to another. 
B)  It depends on what the changed nucleotide is. 
C)  A frameshift mutation for all of the subsequent amino acids in the protein. 
D)  No effect as the problem nucleotide would be corrected by RNA editing mechanisms. 
E)  A silent mutation and no change in the encoded amino acid. 
A)  A missense mutation from one encoded amino acid changing to another. 
B)  It depends on what the changed nucleotide is. 
C)  A frameshift mutation for all of the subsequent amino acids in the protein. 
D)  No effect as the problem nucleotide would be corrected by RNA editing mechanisms. 
E)  A silent mutation and no change in the encoded amino acid.

Question 20

You have identified a bacterial protein that has retained the starting fMet in its protein sequence. Which of the following is likely true of this protein?

Accepted Answer

A)  It is likely nonfunctional, since bacteria use posttranslational cleavage of fMet to make functional proteins. 
B)  It will be a functional bacterial protein, since all functional proteins must begin with fMet. 
C)  It will be not be able to be chemically modified, so it will be sent to the Golgi for secretion. 
D)  It will show improper protein sorting and will likely remain in the ER. 
E)  It will likely form a disulfide bond with a second peptide chain, forming a protein complex. 
A)  It is likely nonfunctional, since bacteria use posttranslational cleavage of fMet to make functional proteins. 
B)  It will be a functional bacterial protein, since all functional proteins must begin with fMet. 
C)  It will be not be able to be chemically modified, so it will be sent to the Golgi for secretion. 
D)  It will show improper protein sorting and will likely remain in the ER. 
E)  It will likely form a disulfide bond with a second peptide chain, forming a protein complex.

Exam 9: The Molecular Biology of Translation

Many antibiotics cause mispairing between codons and anticodons. What fatal effect would this mispairing have on the cell?

_________help control ribosome formation and binding of the initiator tRNA.

How many different aminoacyl- tRNA synthetases can be found in a given organism's cells?

What is the cellular location of the stages of translation in bacteria and eukaryotes?

A signal sequence at the N terminus of newly synthesized proteins will direct the protein to the_______ for protein packaging.

Sidney Brenner demonstrated that the triplet code is, in fact, nonoverlapping. Assuming a nonoverlapping code, how many COMPLETE codons would the following sequence encode before encountering a stop codon? 5' - AUGCGAUUAUAGUGC - 3'

Which of these choices represents one possible corresponding mRNA sequence that can be transcrib from the following DNA template? 5' - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3'

During elongation, the charged tRNA is recruited to which location on the ribosome?

Ribosomal subunits are measured in which units, which describe the speed of sedimentation of a substance during centrifugation?

Describe the technique of two- dimensional gel electrophoresis. What are the two dimensions referring to? How is this technique different from conventional gel electrophoresis, and when would it be used?

A portion of mRNA attached to a ribosome reads: 5' GACCAUUUUUGA 3' In the polypeptide produced, what amino acid will be attached to the amino group of the histidine encoded by this mRNA?

A mutagen has introduced a frame- shift mutation by adding one nucleotide base. Which of the following could be a reversion mutation for this particular mutant?

Binding of what protein initiates translation- termination events that result in polypeptide release and dissociation of ribosomal subunits?

What is necessary for a eukaryotic RNA to be recognized and bound by the small subunit of the ribosome?

If you are designing an antibiotic that inhibits peptide bond formation, what enzyme would you target?

During translation initiation in bacteria, the amino acid on the initiator tRNA is______ .

A portion of an mRNA attached to a ribosome reads: 5' GACCAUUUUUGA 3' If a tRNA with a Phenylalanine amino acid attached is in the P site of the ribosome, an empty tRNA present in the E site that delivered which amino acid?

How does the eukaryotic initiation complex locate the correct start codon?

If the first nucleotide in a codon is mutated to a different nucleotide, what would be the effect on the encoded protein?

You have identified a bacterial protein that has retained the starting fMet in its protein sequence. Which of the following is likely true of this protein?

The Molecular Basis of Heredity, Variation, and Evolution

Transmission Genetics

Cell Division and Chromosome Heredity

Inheritance Patterns of Single Genes and Gene Interaction

Genetic Linkage and Mapping in Eukaryotes

Genetic Analysis and Mapping in Bacteria and Bacteriophage

Dna Structure and Replication

Molecular Biology of Transcription and Rna Processing

Chromosome Chapter Title Tbd

Gene Mutation, Dna Repair, and Homologous Recombination

Chromosome Chapter Title Tbd

Regulation of Gene Expression in Bacteria and Bacteriophage

Regulation of Gene Expression in Eukaryotes

Analysis of Gene Function by Forward Genetics and Reverse Genetics

Recombinant Dna Technology and Its Applications

Genomics: Genetics From a Whole-Genome Perspective

Organelle Inheritance and the Evolution of Organelle Genomes

Developmental Genetics

Genetic Analysis of Quantitative Traits

Population Genetics and Evolution at the Population, Species, and Molecular Levels

Filters